Nested PCR (polymerase chain reaction) kit for detecting duck-manure pollution in water body and detection method thereof
A kit and duck manure technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problem of untraceable methods for detecting fecal contamination, and achieve good specificity and high sensitivity , the effect of high application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Nested PCR kit for detecting duck manure pollution in water, including two pairs of nested PCR primers, dNTP, PCR buffer, Taq enzyme, Mg 2+ and ddH 2 O, two pairs of nested PCR primers are:
[0037] SDF: 5’-GCATAGGGCAACACGGAAAG-3’
[0038] SDR: 5’-GTTCTGGGTGTTGTCCGGTA-3’
[0039] NDF: 5’‐CCACGTAAATGCCAAAGATG‐3’
[0040] NDR: 5'‐CTGAGCTAGAGGAAGGCT‐3'. The above two pairs of nested PCR primers were custom-synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0041] ddH above 2 O is sterile double distilled water. The concentration of Taq enzyme is 5U / ul. Mg 2+ The concentration of the solution is 25mmol / L, which is MgCl 2 solution. The concentration of dNTPs was 2.5 mmol / L. PCR buffer is 10×PCR buffer (purchased from Takara, Code No.RR001A)
[0042] Collect fresh chicken, human, pig, cow, sheep, duck, goose, and mouse feces, extract DNA from 0.2 grams of feces, and use it as a template for the first round of PCR amplification. The reaction system is 2.5ul ...
Embodiment 2
[0047] Take 0.2 grams of duck feces to extract DNA, and the measured DNA concentration is 79.2ng / ul. The DNA solution is serially diluted by four-fold dilution method, and the dilution times are 1 / 4 and 1 / 4 respectively. 2 , 1 / 4 3 , 1 / 4 4 , 1 / 45, 1 / 46, 1 / 47, 1 / 48, and 1 / 49 duck feces DNA solutions, respectively take the DNA solutions of various concentrations as templates for the first round of PCR amplification, and the reaction system is 2.5ul of 10 ×PCR buffer; 2.5ul dNTP; 0.1ul Taq enzyme; 2ul of 25mmol / L Mg 2+ Solution; 0.5ul concentration of 10umol / L upstream and downstream primers SCF, SCR; 2ul template DNA; sterilized ddH 2 Make up to 25ul with O; the reaction conditions are 95°C, pre-denaturation for 5min; 40 cycles of 95°C for 30s, 57°C for 30s, 72°C for 45s; 72°C for 7min, and storage at 4°C.
[0048] Perform 1% agarose gel electrophoresis on the first round of PCR products, the electrophoresis conditions are: voltage 120V, current 440mA, time 25min, the electrop...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com