Unlock instant, AI-driven research and patent intelligence for your innovation.

Primers and methods for detecting tobacco mosaic virus lamp

A tobacco mosaic virus and detection method technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of low detection sensitivity, expensive detection instruments, expensive instruments, etc., and achieve operational The effect of cumbersome steps, economic sensitivity, and simple operation

Active Publication Date: 2018-01-02
陈定虎
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the detection methods of plant viruses mainly include biology, serology and molecular biology. The biological method is to use the virus indicator plant to detect the presence or absence of the virus, which generally takes 7-10 days; the serological method is based on the antigen-antibody Generally, it only takes about 4-6 hours to detect the virus, but it requires specific antiserum, and the detection sensitivity is not high, and there are still non-specific problems; molecular biology methods mainly refer to the PCR method. The method is fast and has high accuracy, but it requires expensive detection instruments and related equipment, and for viruses like TMV, since its dilution limit is 10 6 times, that is, to dilute the disease juice to 10 6 Therefore, it is necessary to detect the potential TMV with a very high sensitivity detection method. The sensitivity of the above three methods is difficult to achieve, so there will be a possibility of missed detection, so there is an urgent need to study new detection methods
[0007] At present, the existing detection methods have cumbersome detection steps and expensive instruments, and cannot quickly and conveniently identify the authenticity of shark fins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and methods for detecting tobacco mosaic virus lamp
  • Primers and methods for detecting tobacco mosaic virus lamp
  • Primers and methods for detecting tobacco mosaic virus lamp

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] A kind of primer used for tobacco mosaic virus LAMP detection, comprising:

[0087] Forward outer primer F3: 5'-TTACGGAATTACTACTCCATCT-3';

[0088] Reverse outer primer B3: 5'-GGTCTAATACTGCGTTGTACC-3';

[0089] Forward internal primer FIP:

[0090] 5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3';

[0091] Wherein said forward inner primer FIP comprises F1c and F2 sequences:

[0092] F1c: TGTTTGGAACTGATTACCTAAGGCA;

[0093] F2: GTGTTCTTGTCATCAGCGT;

[0094] Reverse inner primer BIP:

[0095] 5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3'

[0096] The reverse inner primer BIP includes B1c and B2 sequences:

[0097] B1c: ACTTTAAAGTCACTATCAGGGA;

[0098] B2: CTGTCGTTCAACGACAATTCAGC.

Embodiment 2

[0100] A method for detecting tobacco mosaic virus LAMP, comprising the following steps:

[0101] A, extraction of tobacco mosaic virus RNA

[0102] Using nano magnetic beads to extract tobacco mosaic virus RNA;

[0103] B. Establishment of LAMP reaction system

[0104] The 25 μL LAMP reaction system includes 20 μL pre-reaction solution and 5 μL DNA template, of which 20 μL pre-reaction solution consists of the following components:

[0105]

[0106]

[0107] The sequences of the primers include:

[0108] Forward outer primer F3: 5'-TTACGGAATTACTACTCCATCT-3';

[0109] Reverse outer primer B3: 5'-GGTCTAATACTGCGTTGTACC-3';

[0110] Forward internal primer FIP:

[0111] 5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3';

[0112] Wherein said forward inner primer FIP comprises F1c and F2 sequences:

[0113] F1c: TGTTTGGAACTGATTACCTAAGGCA;

[0114] F2: GTGTTCTTGTCATCAGCGT;

[0115] Reverse inner primer BIP:

[0116] 5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGG...

Embodiment 3

[0127] A method for detecting tobacco mosaic virus LAMP, comprising the following steps:

[0128] A, extraction of tobacco mosaic virus RNA

[0129] Using nano magnetic beads to extract tobacco mosaic virus RNA;

[0130] 1) Sample preparation: Take 0.1 g of tobacco mosaic virus-infected tissue and add 1 mL of extraction buffer to grind to obtain a sample;

[0131] 2) Cleaning the nano-magnetic beads: take out the nano-magnetic beads into the PCR tube, wash the nano-magnetic beads with ddH2O repeatedly for 3 times, and absorb the ddH2O under the action of the magnet;

[0132] 3) Binding: add 100 μL of sample to the PCR tube, mix the sample and nano-magnetic beads with a pipette gun, and adsorb at room temperature;

[0133] 4) Cleaning: Remove the supernatant under the action of a magnet, and wash the nano-magnetic beads for 3 times;

[0134] 5) Cleavage: add 50 μL ddH2O to the PCR tube, use a pipette gun to mix the nano-magnetic beads, 95 ° C, 10 min;

[0135] 6) Sampling: Ad...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and method for detecting tobacco mosaic virus LAMP. The primer comprises a forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3', a backward outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3', a forward inner primer FIP:5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3' and a backward inner primer BIP:5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3'. The method comprises the following steps: extracting tobacco mosaic virus RNA; establishing a LAMP reaction system; adding a pre-reaction solution and a to-be-detected sample into a Loopamp reaction test tube; mixing; putting the mixture into a LAMP turbidity meter for reaction; and detecting the inspection result by a LAMP turbidity meter method or fluorescent visual inspection method. The invention aims at providing a primer and a method for detecting tobacco mosaic virus LAMP, wherein the method has the characteristics of high speed, high detection sensitivity, easiness in operation, direct result reading and the like.

Description

technical field [0001] The invention relates to a primer for detecting tobacco mosaic virus LAMP, and also relates to a method for detecting tobacco mosaic virus by using the primer, which belongs to the field of biotechnology. Background technique [0002] Tobacco mosaic virus, abbreviated as TMV, is an RNA virus that specifically infects plants, especially tobacco and other Solanaceae plants, and is a representative species of the genus Tobamovirus. The virus is Ivanovsky D.I.Iwanowski in 1892 for the first time proved the existence of this TMV. Stanley W.M.Stanley first isolated the TMV virus-like crystals from the squeezed juice of diseased tobacco leaves in 1935. He learned that the protein also contained nucleic acid, and confirmed that the pathogen was the virus. The virus is extremely stable, and because it can proliferate in large quantities in diseased leaves, 2 grams of crystals can be purified from 1 liter of diseased leaf juice. TMV particles are 300 nanometer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/70C12Q1/701C12Q2531/119
Inventor 陈定虎刘恭源陈祖华熊仁广管维周敏刘晓媚张静冯雪雅吴颖儿
Owner 陈定虎