Recombinant bacillus calmette-guerin for preventing animal toxoplasmosis and preparation method

A technology for recombining BCG and toxoplasmosis, applied in the direction of microorganism-based methods, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of weak anti-infection ability, recovery of virulence, etc., and achieve easy transportation and storage , good thermal stability, cost reduction effect

Inactive Publication Date: 2015-10-07
JILIN UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The research on Toxoplasma gondii vaccines has undergone various explorations such as inactivated vaccines and live attenuated vaccines. The former stimulates the body to produce weak anti-infection ability, while the latter can produce better protection, but due to the recovery of virulence after mutation, therefore not applicable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus calmette-guerin for preventing animal toxoplasmosis and preparation method
  • Recombinant bacillus calmette-guerin for preventing animal toxoplasmosis and preparation method
  • Recombinant bacillus calmette-guerin for preventing animal toxoplasmosis and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The preparation method of the recombinant BCG vaccine for the prevention of canine toxoplasmosis by the shuttle expression vector, the steps are as follows:

[0032] Two pairs of primers were designed according to the DNA sequence of the canine interleukin-2 (DIL-2) gene, the Rhomboid gene DNA sequence of the protective antigen of Toxoplasma gondii, and the physical map of the shuttle vector pMV261, and restriction sites were introduced.

[0033] Canine interleukin 2 (DIL-2) upstream primer IL-F:5`-CCG GAATTC ATGTACAAGATACAACTCTTGTCTT -3`, 5` end contains EcoR I restriction site.

[0034] Canine Interleukin 2 (DIL-2) Downstream Primer IL-R:5`-CGC GGATCC TGTCATTGTTGAGTAGATGCTTT - 3`, 5` end contains Bam HI restriction site.

[0035] Rhomboid gene upstream primer ROM-F:5`- GGATCC ATGCCTATTCGCTTTCTCG-3`, 5` end contains Bam HI restriction site.

[0036] Rhomboid gene downstream primer ROM-R: 5`- AAGCTT AATGTAGGACAAAATCCCTGTGG-3, 5` end contains Hin...

Embodiment 2

[0039] Combined expression vector is used for the recombinant BCG preparation method of canine toxoplasmosis prevention, and the steps are as follows:

[0040] Two pairs of primers were designed according to the DNA sequence of the canine interleukin-2 (DIL-2) gene, the Rhomboid gene DNA sequence of the protective antigen of Toxoplasma gondii, and the physical map of the shuttle vector pMV261, and restriction sites were introduced.

[0041] Canine interleukin 2 (DIL-2) upstream primer IL-F:5`-CCG GAATTC ATGTACAAGATACAACTCTTGTCTT -3`, 5` end contains EcoR I restriction site.

[0042] Canine Interleukin 2 (DIL-2) Downstream Primer IL-R:5`-CGC GGATCC TGTCATTGTTGAGTAGATGCTTT - 3`, 5` end contains Bam HI restriction site.

[0043] Rhomboid gene upstream primer ROM-F:5`- GGATCC ATGCCTATTCGCTTTCTCG-3`, 5` end contains Bam HI restriction site.

[0044] Rhomboid gene downstream primer ROM-R: 5`- AAGCTT AATGTAGGACAAAATCCCTGTGG-3, 5` end contains Hind III restric...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides recombinant bacillus calmette-guerin for preventing animal toxoplasmosis and a preparation method of the recombinant bacillus calmette-guerin. The recombinant bacillus calmette-guerin (rBCG) can serve as an adjuvant and a carrier and has exogenous genes and living vaccine; after a user is inoculated with the recombinant bacillus calmette-guerin, the body of the user has specific humoral immunity and cellular immunity, cell factors and toxoplasma antigen protein can be expressed, by the expressed cell factors, the expressed protein has a high immunoprotection effect, advantages of the expressed cell factors and advantages of the expressed protein are combined, and the purpose of preventing the toxoplasmosis well is achieved. The recombinant bacillus calmette-guerin is high in thermostability, easy to convey and store and easy to produce, does not need to be purified and can be directly used for a immunoprotection test, and complex working procedures of aftertreatment of the protein are omitted, so that the cost is greatly reduced. The recombinant bacillus calmette-guerin is suitable for vast rural areas.

Description

technical field [0001] The invention provides a recombinant BCG vaccine for preventing toxoplasmosis in animals, and also provides a preparation method of the vaccine, which belongs to the technical field of vaccine preparation. Background technique [0002] Toxoplasmosis is a zoonosis caused by Toxoplasma gondii that is widely distributed worldwide. It has a very wide host range and can infect humans and most animals. Toxoplasma gondii infection is a serious hazard to animal husbandry production, mainly causing miscarriage, teratogenicity, stillbirth and so on. The harm of Toxoplasma gondii is huge, but the prevention and treatment of this disease has not yet found an ideal drug. Although antiparasitic drugs are highly effective, cheap and easy to administer, the emergence of drug resistance in Toxoplasma gondii and the general concern of drug residues are increasing. In comparison, vaccines are relatively safe, free of chemical residues and pollution-free. Some scholar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/04A61K48/00A61P33/02C12N1/21C12N15/74C12N15/30C12N15/26C12R1/32
Inventor宫鹏涛罗文武张西臣李建华潘乐杨举李赫张楠尹继刚
OwnerJILIN UNIV