G RNA sequence used for knocking out human BTF gene and knocking-out method thereof
A DNA sequence, gene technology, applied in microorganism-based methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as poor stability, chromosome deletion, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0011] Example 1 CRISPR / Cas9BTF-guideRNA plasmid construction, cell transfection and mutation identification
[0012] (1) CRISPR / Cas9BTF-guideRNA plasmid construction
[0013] Synthetic nucleotide sequence 5'-TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGAGGAGGTAGATATCATCGGTTTTGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC-3', and its reverse complement 5'-GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCGATGATATCTACCTCCTCCGGTGTTTCGTCCTTCCAAGATATATAAAGCCAAGAAA'. In addition, other gRNA sequences were designed for comparison, specifically as follows: comparison example 1: the gRNA sequence is TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGTATTATCAAGGAGGAGGGTTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC; comparison sequence 2: the gRNA sequence is TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCAGACGACCTTATGGGCAGTAAGGATTAAGGAGTAGA. Each of the three gRNA nucleotide sequences was adjusted to 100 μM with deionized bacterial water, placed in 600ml of boiling water, cooled and annealed at room temperature naturally to form...
Embodiment 2
[0020] Detection of BTF protein in A549 cells after embodiment 2 transfection
[0021]Transfect and screen the cells with BTF gene frameshift mutations obtained in Example 1, inoculate them into 6-well plates for expanded culture, set the A549 cells before transfection as the control, add 100-200 μl 3╳SDS-PAGE loading buffer, boiling water Boil for 5-7 minutes, take 10 to 20ul for SDS-PAGE protein electrophoresis. After the electrophoresis was completed, according to the routine protein wet transfer, 5% skimmed milk powder, 0.05MPBSPH7.4 was blocked for 3 hours, and the blocked PVDF membrane was placed in rabbit anti-human BTF antibody (1:200, Abcam / ab181240, Cambridge Science Park, UK), The buffer solution is 5% skimmed milk powder, 0.05MPBSPH7.2, room temperature for 2hr or overnight at 2-8°C, wash with washing buffer 0.05MPBSPH7.2, 0.1%Tween-20 four times, each time for 5 minutes, and then transfer the membrane to 0.05MPBSPH7.2, 0.2%Tween-20, 1:5000 dilution of goat anti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 