G RNA sequence used for knocking out human BTF gene and knocking-out method thereof

A DNA sequence, gene technology, applied in microorganism-based methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as poor stability, chromosome deletion, etc.

Inactive Publication Date: 2015-12-02
BEIJING INST OF GENOMICS CHINESE ACAD OF SCI CHINA NAT CENT FOR BIOINFORMATION
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] BTF was newly discovered by KASOF and others when they used the yeast two-hybrid system to search for the interacting protein of the virus anti-apoptotic protein E1B19K. It is located in the segment of chromosome 6q21-23. This segment has poor stability and is prone to chromosome deletions in various tumors.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • G RNA sequence used for knocking out human BTF gene and knocking-out method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0011] Example 1 CRISPR / Cas9BTF-guideRNA plasmid construction, cell transfection and mutation identification

[0012] (1) CRISPR / Cas9BTF-guideRNA plasmid construction

[0013] Synthetic nucleotide sequence 5'-TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGAGGAGGTAGATATCATCGGTTTTGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC-3', and its reverse complement 5'-GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCGATGATATCTACCTCCTCCGGTGTTTCGTCCTTCCAAGATATATAAAGCCAAGAAA'. In addition, other gRNA sequences were designed for comparison, specifically as follows: comparison example 1: the gRNA sequence is TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGTATTATCAAGGAGGAGGGTTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC; comparison sequence 2: the gRNA sequence is TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCAGACGACCTTATGGGCAGTAAGGATTAAGGAGTAGA. Each of the three gRNA nucleotide sequences was adjusted to 100 μM with deionized bacterial water, placed in 600ml of boiling water, cooled and annealed at room temperature naturally to form...

Embodiment 2

[0020] Detection of BTF protein in A549 cells after embodiment 2 transfection

[0021]Transfect and screen the cells with BTF gene frameshift mutations obtained in Example 1, inoculate them into 6-well plates for expanded culture, set the A549 cells before transfection as the control, add 100-200 μl 3╳SDS-PAGE loading buffer, boiling water Boil for 5-7 minutes, take 10 to 20ul for SDS-PAGE protein electrophoresis. After the electrophoresis was completed, according to the routine protein wet transfer, 5% skimmed milk powder, 0.05MPBSPH7.4 was blocked for 3 hours, and the blocked PVDF membrane was placed in rabbit anti-human BTF antibody (1:200, Abcam / ab181240, Cambridge Science Park, UK), The buffer solution is 5% skimmed milk powder, 0.05MPBSPH7.2, room temperature for 2hr or overnight at 2-8°C, wash with washing buffer 0.05MPBSPH7.2, 0.1%Tween-20 four times, each time for 5 minutes, and then transfer the membrane to 0.05MPBSPH7.2, 0.2%Tween-20, 1:5000 dilution of goat anti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering, and particularly relates to an sgRNA sequence used for knocking out a human BTF (Bcl-2-associated transcription factor 1) gene. The gRNA in a cell can be specifically combined with 251-269bp of a human BTF coding sequence and form a compound with Cas, the BTF gene nucleotide sequence is specifically cut, a cell non-homologous end joining (NHEJ) repairing mechanism is used for causing BTF gene frameshift mutation, and then the cell with the BTF gene knocked out is obtained.

Description

technical field [0001] The invention relates to the field of genetic engineering. More specifically, the present invention relates to stably knocking out the BTF (Bcl-2-associated transcription factor 1) gene at the cellular level. Background technique [0002] BTF was newly discovered by KASOF and others when they used the yeast two-hybrid system to search for the interacting protein of the virus anti-apoptotic protein E1B19K. It is located in the segment of chromosome 6q21-23. This segment has poor stability and is prone to chromosome deletions in various tumors. . BTF is strongly expressed in various epithelial tissues, such as skeletal muscle, placenta, heart, brain, lung, kidney and pancreas; in tumor cells HeLaS3, leukemia cells HL-60, K-562, MOL74, colon adenocarcinoma SW480 , lung cancer cell A549 and Bucking's lymphoma cell Raji are expressed. [0003] BTF has basiczipper-like (located at 110-126aa), Myb-like (located at 522-531aa) DNA binding domains, in normal ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/70C12R1/19
Inventor邵长君王绪敏王延强于军
OwnerBEIJING INST OF GENOMICS CHINESE ACAD OF SCI CHINA NAT CENT FOR BIOINFORMATION