Creation method of low-methane-emission paddy rice variety

A rice and methane technology, applied in the field of gene editing technology and crop breeding, can solve the problems of reducing the amount of methane in rice fields and poor results, and achieve the effect of high efficiency and low cost

Active Publication Date: 2018-12-18
BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previous studies have adopted many strategies to reduce methane release in paddy fields, such as changing farming methods, fertilization methods, etc., but the effect is not good

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Creation method of low-methane-emission paddy rice variety
  • Creation method of low-methane-emission paddy rice variety
  • Creation method of low-methane-emission paddy rice variety

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Sequence analysis and gene editing target design of rice susiba-like gene

[0030] The sequence of the rice susiba-like gene is shown in SEQ ID NO.1. Sequence analysis shows that the gene contains 7 exons, respectively 46-291 (first exon), 1352-1525 (second exon), 2529-3072 (third exon) in the sequence table. exon), 3674-3839 (fourth exon), 3926-4084 (fifth exon), 4481-5048 (sixth exon).

[0031] The material tested was Minghui 86, so according to the experimental purpose of the present invention, three cas9 recognition sites were designed on the third intron and the fourth exon, such as figure 1 . The recognition target sequences are gRNA1: ggtggtagagcctccaatag (promoter region), gRNA2: gcatgaggttgagtgcagcc (promoter region), gRNA3: gtacatacagctggtatgat (coding region).

Embodiment 2

[0032] Example 2: Construction of Targeting Vector and Genetic Transformation of Rice

[0033] In this experiment, the CRISPR / cas9 vector was purchased from Beijing Weishang Lide Biotechnology Co., Ltd. The backbone vector pCXUN-Cas9 contains an artificially synthesized cas9 protein sequence of 4206 base pairs, which can encode 1401 amino acids and is driven by a Ubiquitin promoter. U6 Promoter. Two promoters drive the transcription of cas9 protein and gRNA respectively. The fragment was synthesized by Primer Synthesis Co., Ltd. and connected to the U6 promoter by DNA ligase to form a recombinant plasmid pCXUN-Cas9-gRNA (circular vector).

[0034] In the present invention, the Agrobacterium carrying the vector pCXUN-Cas9-gRNA can transform the callus of japonica rice, indica rice and glutinous rice, and obtain transgenic materials through screening, differentiation and rooting of resistant callus, Minghui 86 is as follows For example, the specific steps are as follows:

[0...

Embodiment 3

[0040] Example 3: Genotype detection and phenotype investigation of rice susiba-like gene edited body

[0041] A) Obtained genotype and phenotype of target gRNA1

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a creation method of a low-methane-emission paddy rice variety, wherein the susiba-like gene sequence of the rice is represented as the SEQ ID No.1; the ATG initiation site andATG promoter domain position, which encode the susiba-like gene, are subjected to gene edition to obtain a rice mutant with frameshift mutation of the susiba-like gene; when the susiba-like gene is inactivated or is reduced in expression level, the metabolism causing transportation and accumulation of carbohydrates in the paddy rice is initiated, thus reducing the methane emission of a rice field.

Description

technical field [0001] The invention relates to the fields of gene editing technology and crop breeding, in particular to a method for creating rice varieties with low methane emission. Background technique [0002] The national conditions of my country's large population and small per capita arable land determine that ensuring my country's food security is the most important responsibility of agriculture. Rice hybrid breeding has made an important contribution to ensuring my country's grain production. However, with the progress of the times and increasingly complex environmental changes, it is difficult to efficiently meet the increasingly complex environmental changes and diversified market demands by pure yield breeding. The breeding focus of some rice breeders is also gradually focusing on the research and development of quality diversity and environment-friendly rice. [0003] The greenhouse effect has always been a global environmental issue with a high degree of co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N9/22A01H5/00A01H6/46
CPCC12N9/22C12N15/8213C12N15/8243Y02P60/22
Inventor朱义旺王锋苏军沈学良林雅容单贞范美英
OwnerBIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI