Gene LcFLC for retarding flowering time of plants and application thereof

A gene and regulation gene technology, applied in the field of vector construction, delayed flowering gene, and cloning of plant flowering time gene LcFLC, can solve the problems of low temperature-induced lychee flowering regulation mechanism and molecular mechanism are unclear, delayed flowering time and other problems

Inactive Publication Date: 2015-12-02
SOUTH SUBTROPICAL CROPS RES INST CHINESE ACAD OF TROPICAL AGRI SCI
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The expression of FLC and its homologous genes in plants such as Arabidopsis can significantly delay its flowering time, but the response of perennial plant litchi to the external environment is different from that of herbaceous plant Arabidopsis, and the regulatory mechanism and molecular mechanism of low temperature induced litchi flowering are still unknown. don't know

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene LcFLC for retarding flowering time of plants and application thereof
  • Gene LcFLC for retarding flowering time of plants and application thereof
  • Gene LcFLC for retarding flowering time of plants and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Cloning method and sequence analysis of embodiment 1 LcFLC gene

[0027] The cloning method and sequence analysis of the above-mentioned LcFLC gene include the following steps.

[0028] 1. Extraction and detection of lychee RNA The leaves of the 'feizixiao' lychee variety were used as materials. The RNA was extracted using the RNAOUT kit of Beijing Huayueyang Biological Co., Ltd. (refer to the instruction manual for the specific method), and then digested and removed with DNaseI (TaKaRa) DNA in total RNA (refer to the instructions for specific methods).

[0029] Litchi total RNA quality and integrity detection: Take 1 μL RNA solution and dilute it to 100 μL, measure the light absorption values ​​at 260, 280 and 320 nm with an ultraviolet nucleic acid protein detector and calculate A 260nm / A 280nm Ratio; at the same time, take 2 μL RNA samples and use 1.2% agarose gel electrophoresis to detect the integrity of the total RNA. When A 260 / A 280 When the ratio is betw...

Embodiment 2

[0037] Example 2 Expression Analysis of LcFLC Gene in 'Concubine Smile' Litchi The expression analysis of LcFLC gene in 'Concubine Smile' litchi was carried out by Real-Time PCR reaction, and the specific embodiment is as follows.

[0038] 1. Experimental materials In order to analyze the expression of LcFLC gene in the process of litchi flower bud differentiation, RNA samples from 8 different parts of litchi and different growth stages were selected for analysis. The samples of different parts are as follows: mature leaf 1 (October), Mature leaf 2 (February), young leaf 1 (October), young leaf 2 (February), leaf buds, flower buds, flower spikes and phloem. The samples of different growth stages are the mature leaves and terminal buds of the last branch shoot of litchi 'Feizixiao' taken every 3 weeks since 2012.10.22 during the flowering process.

[0039] 2. Quantitative primer design According to the cloned gene sequence, refer to the general principles of Real-timePCR primer...

Embodiment 3

[0042] Example 3 A plant expression vector containing the LcFLC gene was constructed and transformed into Nicotiana benthamiana by Agrobacterium injection, and the subcellular localization of the LcFLC gene was further analyzed.

[0043] 1. Vector construction This experiment uses the pBI121 vector that has been partially modified (replacing the GUS gene in pBI121 with GFP), referred to as the pBI121-GFP vector (such as Figure 5 A). Select XbaI and SmaI restriction sites for enzyme digestion, then electrophoresis detection and gel cutting to recover fragments of corresponding size. Then use In-fusion? HDCloningKit ligase (Clontech) to connect the obtained target gene into the pBI121-GFP linear vector. The primers for amplifying the target gene with the recombination adapter are LcFLC-GFP-F: GGACTCTAGAGGATCCATGGGCCGGAGGAAGTTGCAG, and LcFLC-GFP-R: GATCGGGGAAATTCGAGCTCCTATTTTAGCAAGGAAAGGG. The connection system is: 1 μL of In-Fusion modified target gene, 1 μL of digested vecto...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a flower formation regulator gene LcFLC obtained from litchi chinensis by separation and application thereof, belongs to the field of biological genes. The invention particularly discloses the nucleotide sequence, cloning method and subcellular localization of the gene LcFLC; due to spatio-temporal expression features at different tissue parts of litchi chinensis, the gene LcFLC has the function of retarding the flowering time of plants. According to the gene LcFLC for retarding the flowering time of plants and the application thereof, provided by the invention, the preliminary knowledge about the floral induction mechanism of litchi chinensis is gained for the first time from the perspective of molecular biology, a foundation is laid for regulating the flowering time by overexpression or expression inhibition of target genes in litchi chinensis, and the gene LcFLC has a very important significance to breeding of new litchi chinensis species by utilizing genetic engineering.

Description

technical field [0001] The invention relates to a gene for delaying flowering, in particular to the cloning, vector construction and application of a gene LcFLC for delaying flowering time of plants, and belongs to the technical field of biological genes. Background technique [0002] litchi( Litchichinensis Sonn.) belongs to the Sapindaceae Litchi genus evergreen fruit tree, is a specialty fruit tree widely cultivated in the subtropical regions of southern my country, with a long history of cultivation and rich germplasm resources. The instability of flower formation during litchi cultivation is an important reason for low or unstable yield. Therefore, research on litchi flower formation has become a hot spot. [0003] Litchi flowering involves complex environmental and genetic factors. Studies have shown that temperature is the most critical factor affecting litchi flowering (Menzeletal., 1985; Menzeletal., 1986; Southwicketal., 1986). Menzel's research group conducted ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/84A01H5/00
Inventor魏永赞张红娜石胜友李伟才刘丽琴舒波
OwnerSOUTH SUBTROPICAL CROPS RES INST CHINESE ACAD OF TROPICAL AGRI SCI