Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application method of EB virus encoded EBER-1

An application method and coding technology, applied in the field of tumor molecular biology, can solve the problems of EBER-1 and nasopharyngeal carcinoma patients' auxiliary diagnosis or efficacy prediction without literature reports, and achieve the effect of important promotion and application prospects and far-reaching clinical significance.

Inactive Publication Date: 2015-12-16
CENT SOUTH UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are no literature reports on EBER-1 and the auxiliary diagnosis or curative effect prediction of patients with nasopharyngeal carcinoma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application method of EB virus encoded EBER-1
  • Application method of EB virus encoded EBER-1
  • Application method of EB virus encoded EBER-1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1, in situ hybridization detection of EBER-1 expression in normal nasopharyngeal epithelium and nasopharyngeal carcinoma

[0025] 1. Material method

[0026] 1.1 Design and synthesis of hybridization probes

[0027] In order to detect the expression of EBER-1 by in situ hybridization, we designed an oligonucleotide probe for detecting EBER-1 expression by in situ hybridization and a positive control in situ hybridization oligonucleotide probe.

[0028]EBER-1 probe: AGACACCGTCCTCACCACCCGGGACTTGTA

[0029] Positive control probe (to detect the housekeeping gene GAPDH):

[0030] GAPDH probe: CAGUAGAGGCAGGGAUGAUGUUCU

[0031] The gene-specific oligonucleotide probe sequences designed above were synthesized by chemical synthesis method, and uracil in the probe sequences was labeled with biotin (bio-U) during the synthesis process.

[0032] 1.2 Oligonucleotide probe labeling kit and in situ hybridization detection reagent

[0033] Digoxigenin oligonucleotide tail...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application method of EB virus encoded small RNA-1 (Epstein-Barr virus encoded small RNA-1, EBER-1). The research proves that the expression level of EBER-1 in the nasopharyngeal carcinoma tissue is in negative correlation with the clinical stages, the tumor sizes and the lymphatic metastasis of the nasopharyngeal carcinoma patient; if no expression or low expression of EBER-1 exists in the normal nasopharyngeal epithelia, while the expression of EBER-1 in nasopharyngeal carcinoma tissue is up-regulated, the nasopharyngeal carcinoma patient with higher EBER-1 expression in the nasopharyngeal carcinoma tissue have smaller possibilities of recurrence and metastasis than the nasopharyngeal carcinoma patient with lower EBER-1 expression, and the prognosis is better, therefore, the application of the expression of EBER-1 in the predication of recurrence and metastasis for the auxiliary diagnosis of the nasopharyngeal carcinoma patient can provide powerful biomolecular basis for the prognosis of the nasopharyngeal carcinoma patient, and thus the application method has profound clinical significances and important popularization and application prospects.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and in particular relates to an in situ assay for detecting the relationship between the expression level of small RNA-1 (EBER-1) encoded by Epstein-Barr virus in paraffin-embedded samples of nasopharyngeal carcinoma and the recurrence and metastasis of nasopharyngeal carcinoma Hybridization probe, detection kit and application method thereof. Background technique [0002] Nasopharyngeal carcinoma (Nasopharyngeal Carcinoma, NPC) is a common malignant tumor of the head and neck in southern my country. Due to the hidden location of the disease, it is difficult to detect early, and it is very easy to metastasize. The rate of cervical lymph node metastasis in newly diagnosed patients is as high as 80%. Radiation therapy is currently the most commonly used clinical treatment for nasopharyngeal carcinoma. 60-70% of patients can achieve good curative effect, but 20-30% of patients still have recur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/118
Inventor 张文玲李桂源曾朝阳熊炜李小玲李夏雨范松青石磊周鸣向波
Owner CENT SOUTH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com