Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Short-chain dehydrogenase, gene of short-chain dehydrogenase, recombinant expression vector, genetically engineered bacterium and application

A technology of short-chain dehydrogenase and genetically engineered bacteria, used in the preparation of optically pure chiral alcohols, in the field of short-chain dehydrogenase and its genes, can solve the problem of less biological catalysts, and achieve mild and easy reaction conditions. The effect of preparation and good industrial application development prospect

Inactive Publication Date: 2016-01-13
ZHEJIANG UNIV
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most biocatalysts catalyze the asymmetric reduction process of hypochiral ketones following the Prelog rule, and there are relatively few biocatalysts that follow the anti-Prelog rule to catalyze the reduction of hypochiral ketones
This will limit the preparation of anti-Prelog chiral alcohol as an important intermediate in the synthesis of chiral drugs and the promotion of biocatalytic green synthesis technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Short-chain dehydrogenase, gene of short-chain dehydrogenase, recombinant expression vector, genetically engineered bacterium and application
  • Short-chain dehydrogenase, gene of short-chain dehydrogenase, recombinant expression vector, genetically engineered bacterium and application
  • Short-chain dehydrogenase, gene of short-chain dehydrogenase, recombinant expression vector, genetically engineered bacterium and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Acquisition of EmpedobacterbrevisZJUY-1401 short-chain dehydrogenase gene, recombinant plasmid construction and transformation into Escherichia coli

[0040] Extract the whole genome DNA of EmpedobacterbrevisZJUY-1401 bacterial body with DNA extraction kit, take this DNA as template, upstream primer (GCTGA GGATCC ATGTCAATATTAAAGATAAGGTAGC) and downstream primers (GCATC CTCGAG TTAAACTGCTGTATATCTCTCCATC) was used as primer for PCR amplification reaction. The amount of each component in the PCR reaction system (total volume 50μL): 5×PrimeSTAR TM 10 μL of HSDNApolymerase Buffer, 4 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of each upstream primer and downstream primer at a concentration of 50 μM, 1 μL of genomic DNA, PrimeSTAR TM HSDNApolymerase 0.5 μL, nucleic acid-free water 32.5 μL. The PCR reaction conditions were as follows: pre-denaturation at 98°C for 1min, followed by a temperature cycle of 98°C for 10s, 56°C for 15s, a...

Embodiment 2

[0043] Example 2: Induced expression of recombinant short-chain dehydrogenase

[0044] The engineered bacteria E.coliBL21(DE3) / pET30a-Ebsdr8 constructed in Example 1 was inoculated into LB liquid medium containing 50 μg / mL kanamycin, cultivated overnight at 37°C, and then inoculated with 1% inoculum size (v / v) Inoculate into 50mL LB medium containing 50μg / mL kanamycin, culture at 37°C, 200rpm to cell concentration OD 600 When the concentration reaches about 0.6, add IPTG with a final concentration of 0.1 mM, induce culture at 26°C for 6 hours, then centrifuge at 8000 rpm at 4°C for 10 minutes to collect the bacterial cells, and store them at -80°C for later use.

Embodiment 3

[0045] Embodiment 3: Separation and purification of recombinant short-chain dehydrogenase

[0046] The thalli cell that embodiment 2 collects is suspended in 10mLNa 2 HPO 4 -NaH 2 PO 4 In buffer solution (100mM, pH8.0), shake well and then crush under ultrasonic wave (effective time 8min). The broken liquid was centrifuged at 12,000 rpm for 10 min to remove cell debris, and the supernatant (crude enzyme liquid) was collected for subsequent separation and purification of the enzyme. The purification column is Ni-NTA, and the column volume is 5mL. First equilibrate the Ni-NTA column with loading equilibration buffer (20mM sodium phosphate, 500mMNaCl and 20mM imidazole, pH7.4), and load the crude enzyme at a rate of 5mL / min. solution, eluted with loading equilibration buffer to remove unadsorbed protein, and finally eluted with elution buffer (20mMT sodium phosphate, 500mM NaCl and 500mM imidazole, pH7.4) to collect the target protein. The enzyme liquid is desalted with HiTr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides short-chain dehydrogenase obtained from Empedobacter brevis, a gene of the short-chain dehydrogenase, recombinant short-chain dehydrogenase, a recombinant expression vector with the gene, a genetically engineered bacterium, a preparation method of the recombinant short-chain dehydrogenase and application of the short-chain dehydrogenase or the genetically engineered bacterium containing the short-chain dehydrogenase to asymmetric reduction of prochiral ketones for preparation of optical pure chiral alcohols. The short-chain dehydrogenase for preparation of the chiral alcohols by asymmetric reduction has remarkable advantages and can be used for synthesis of high-optical-purity chiral alcohols (ee>99%). Moreover, easiness in preparation of catalysts, mild reaction conditions, high substrate adaptability and environment friendliness are realized, asymmetric reduction of the prochiral ketones can be efficiently catalyzed by recombinant cells in an isopropanol-containing reaction system without any coenzymes, and industrial application and development prospect is promising.

Description

technical field [0001] The invention belongs to the technical field of biochemical industry, and specifically relates to a short-chain dehydrogenase and its gene, a recombinant expression vector and a recombinant expression transformant containing the gene, and the short-chain dehydrogenase or a recombinant cell containing the enzyme in Application of asymmetric reduction of a series of latent chiral ketones to prepare optically pure chiral alcohols. Background technique [0002] The two enantiomers of chiral drugs often have different efficacies or their effects are very different. Therefore, the synthesis of single enantiomers has attracted more and more attention. As one of the most important chiral building blocks, optically active chiral alcohols are widely used in the synthesis of chiral drugs and fine chemicals. The asymmetric reduction of latent chiral ketones is an important method for preparing optically active chiral alcohols. In theory, 100% of substrate ketones...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/63C12N1/21C12N15/70C12P7/22
CPCC12N9/0008C12P7/22
Inventor 于洪巍李爱朋
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com