Short-chain dehydrogenase, gene of short-chain dehydrogenase, recombinant expression vector, genetically engineered bacterium and application
A technology of short-chain dehydrogenase and genetically engineered bacteria, used in the preparation of optically pure chiral alcohols, in the field of short-chain dehydrogenase and its genes, can solve the problem of less biological catalysts, and achieve mild and easy reaction conditions. The effect of preparation and good industrial application development prospect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Acquisition of EmpedobacterbrevisZJUY-1401 short-chain dehydrogenase gene, recombinant plasmid construction and transformation into Escherichia coli
[0040] Extract the whole genome DNA of EmpedobacterbrevisZJUY-1401 bacterial body with DNA extraction kit, take this DNA as template, upstream primer (GCTGA GGATCC ATGTCAATATTAAAGATAAGGTAGC) and downstream primers (GCATC CTCGAG TTAAACTGCTGTATATCTCTCCATC) was used as primer for PCR amplification reaction. The amount of each component in the PCR reaction system (total volume 50μL): 5×PrimeSTAR TM 10 μL of HSDNApolymerase Buffer, 4 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of each upstream primer and downstream primer at a concentration of 50 μM, 1 μL of genomic DNA, PrimeSTAR TM HSDNApolymerase 0.5 μL, nucleic acid-free water 32.5 μL. The PCR reaction conditions were as follows: pre-denaturation at 98°C for 1min, followed by a temperature cycle of 98°C for 10s, 56°C for 15s, a...
Embodiment 2
[0043] Example 2: Induced expression of recombinant short-chain dehydrogenase
[0044] The engineered bacteria E.coliBL21(DE3) / pET30a-Ebsdr8 constructed in Example 1 was inoculated into LB liquid medium containing 50 μg / mL kanamycin, cultivated overnight at 37°C, and then inoculated with 1% inoculum size (v / v) Inoculate into 50mL LB medium containing 50μg / mL kanamycin, culture at 37°C, 200rpm to cell concentration OD 600 When the concentration reaches about 0.6, add IPTG with a final concentration of 0.1 mM, induce culture at 26°C for 6 hours, then centrifuge at 8000 rpm at 4°C for 10 minutes to collect the bacterial cells, and store them at -80°C for later use.
Embodiment 3
[0045] Embodiment 3: Separation and purification of recombinant short-chain dehydrogenase
[0046] The thalli cell that embodiment 2 collects is suspended in 10mLNa 2 HPO 4 -NaH 2 PO 4 In buffer solution (100mM, pH8.0), shake well and then crush under ultrasonic wave (effective time 8min). The broken liquid was centrifuged at 12,000 rpm for 10 min to remove cell debris, and the supernatant (crude enzyme liquid) was collected for subsequent separation and purification of the enzyme. The purification column is Ni-NTA, and the column volume is 5mL. First equilibrate the Ni-NTA column with loading equilibration buffer (20mM sodium phosphate, 500mMNaCl and 20mM imidazole, pH7.4), and load the crude enzyme at a rate of 5mL / min. solution, eluted with loading equilibration buffer to remove unadsorbed protein, and finally eluted with elution buffer (20mMT sodium phosphate, 500mM NaCl and 500mM imidazole, pH7.4) to collect the target protein. The enzyme liquid is desalted with HiTr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 