Signal peptide and application thereof in production of L-arginine recombinant bacterium by means of starch

A technology of signal peptide and starch, which is applied in the fields of protein and enzyme engineering, metabolic engineering, and genetic engineering, and can solve the problems that starch cannot be used directly

Active Publication Date: 2016-01-27
JIANGNAN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The high-yield L-arginine strain obtained by the inventor can only use glucose as the main carbon source to ferment and produce L-arginine, and cannot directly use starch as the main carbon source

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Signal peptide and application thereof in production of L-arginine recombinant bacterium by means of starch

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: Primer Design of Signal Peptide Primer in Tandem with α-Amylase

[0020] According to the related gene sequence and α-amyase gene sequence published on NCBI, the signal peptide and gene tandem large fragment primers were designed.

[0021] P1: pMSPamyHindIIIF

[0022] 5'-CC AAGCTT ATGTTCAAAGAAGCACACCATCTCCCTGCTGATCATCTTCCTGCTGGCTTCCGCTGTTCTGGCTAAGCCAATCGAGGCTGCCCCGCCCGGGGCGAAGGAC-3’

[0023] P2: pMSPamyBamHIR

[0024] 5'-CGC GGATCC TTAGTTGCGCCAGGTGTCGTTGA-3

Embodiment 2

[0025] Example 2: Signal peptide replacement of α-amylase gene and its cloning

[0026] [1] Chromosome was extracted from Streptomyceskathirae CCTCCM2012432 as template DNA.

[0027] [2] Design signal peptide and gene tandem PCR primers according to the α-amylase gene sequence published on the NCBI website. Using the genome of StreptomyceskathiraeCCTCCM2012432 as a template, the α-amylase gene with a code-optimized nucleotide sequence such as the Mannasesignalpeptide (abbreviated as MSP) signal peptide shown in SEQ ID NO: 1 was obtained by PCR with large fragment primers. PCR amplification system (50 μL): template 1 μL, upstream and downstream primers 0.5 μL, dNTPMix 4 μL, 10×ExTaqBuffer 5 μL, sterilized ddH2O 38.5 μL, ExTaq DNA polymerase 0.5 μL. PCR reaction conditions: 94°C pre-denaturation, 5min, one cycle; 94°C denaturation, 30s, 56°C annealing, 30s, 72°C extension, 1min30s, 30 cycles; 72°C, 10min, one cycle; 4°C, 10min, one cycle Cycling (in which annealing temperature...

Embodiment 3

[0028] Embodiment 3: Construction of recombinant plasmid pXMJ19-MSPamy

[0029] [1] Construct the recombinant plasmid pMD18-T-MSPamy and introduce it into E.coliJM109. The product recovered by PCR in [2] was connected to the cloning vector pMD18-T, the connection system was 5 μL of solutionI, 4.8 μL of the target gene, 0.2 μL of the pMD18-T plasmid, and ligated overnight at 16°C. The ligation product was transformed into E.coilJM109, spread on an LB plate containing 100ug / mL ampicillin, cultured overnight at 37°C, picked a single colony into 10mL liquid LB medium containing 100ug / mL ampicillin, and shaken at 37°C After culturing overnight, the plasmid was extracted and named pMD18-T-MSPamy. After PCR and restriction enzyme digestion verified that the connection was successful, the bacterial liquid was added to glycerol and stored in a -70°C refrigerator.

[0030] [2] The pMD18-T-MSPamy plasmid extracted in [1] and the expression vector pXMJ19 were subjected to double digestio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a signal peptide and application thereof in production of an L-arginine recombinant bacterium by means of starch, and belongs to the fields of gene engineering and enzyme engineering. Alpha-amylase which comes from Streptomyces kathirae CCTCC M2012432 and does not carry with a self signal peptide is fused with 12 signal peptides of two main secretory pathways, namely, Sec and Tat which come from different microorganisms and then expressed in a high-yield L-arginine strain, and the signal peptide SEQ ID No.1 which can efficiently secrete the alpha-amylase is screened. It is reported for the first time that recombination corynebacterium crenatum CGMCC No.0890 / pMSPamy which is mediated to secrete the alpha-amylase can produce L-arginine through fermentation with cheap starch, and the yield of a 5-L fermentor is 48 g / L under the optimal carbon source adding condition.

Description

technical field [0001] A method for using a signal peptide to enable recombinant bacteria to efficiently secrete specific enzymes to metabolize cheap carbon sources for amino acid production and a method for efficiently producing certain proteins belong to the fields of genetic engineering, protein and enzyme engineering, and metabolic engineering. Background technique [0002] Starch, as the main source of carbon source in microbial industry, generally needs to go through two stages of liquefaction and saccharification before it can be utilized by microorganisms. The microorganisms that can directly use starch as a carbon source mainly include Streptomyces, Bacillus amyloliquefaciens and various molds, and most of the strains used for production cannot directly use starch as a carbon source. There have been reports at home and abroad that the transformation of Saccharomyces cerevisiae directly uses starch as a carbon source to produce ethanol, and the introduction of α-amyl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/77C12N1/21C12N15/31C12N15/56C12P13/10C12R1/15
Inventor饶志明郑俊贤徐美娟杨套伟张显
OwnerJIANGNAN UNIV