Application of EB virus encoded microRNA BART6-3p in preparation of nasopharyngeal carcinoma cell inhibitor

A technology of cancer cells and inhibitors, applied in the field of tumor molecular biology

Active Publication Date: 2016-02-03
CENT SOUTH UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previously, there was no literature report on the function of LOC553103

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of EB virus encoded microRNA BART6-3p in preparation of nasopharyngeal carcinoma cell inhibitor
  • Application of EB virus encoded microRNA BART6-3p in preparation of nasopharyngeal carcinoma cell inhibitor
  • Application of EB virus encoded microRNA BART6-3p in preparation of nasopharyngeal carcinoma cell inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1, real-time fluorescent quantitative PCR method detection confirmed that BART6-3p was up-regulated in nasopharyngeal carcinoma

[0068] 1. Materials and methods:

[0069] Collect 5 cases of normal nasopharyngeal epithelial tissues and 18 cases of nasopharyngeal carcinoma tissues, extract total RNA with Trizol (product of Invitrogen Company), reverse transcribe 2 μg RNA into cDNA with miScript reverse transcription kit (product of Qiagen Company), and use QuantiTectSYBRGreenPCR kit (Qiagen company product) Real-time fluorescent quantitative PCR was used to detect the expression of BART6-3p and internal reference gene RNU6B. The public primers (UniversalPrimer) of microRNA and the specific primers of BART6-3p and RNU6B were all designed and synthesized by Qiagen.

[0070] Real-time fluorescence quantitative PCR reaction system

[0071]

[0072] Real-time fluorescent quantitative PCR reaction steps

[0073]

[0074]

[0075] After the reaction was comp...

Embodiment 2

[0078] Example 2, in situ hybridization detection found that the expression of BART6-3p in nasopharyngeal carcinoma and gastric carcinoma is related to the prognosis of patients

[0079] 1. Material method

[0080] 1.1 Design and synthesis of hybridization probes

[0081] In order to detect the expression of BART6-3p by in situ hybridization, we designed an oligonucleotide probe for detecting the expression of BART6-3p by in situ hybridization and a positive control in situ hybridization oligonucleotide probe.

[0082] BART6-3p probe: UCUAAGGCUAGUCCGAUCCCCG

[0083] Positive control probe (to detect the housekeeping gene GAPDH):

[0084] GAPDH probe: CAGUAGAGGCAGGGAUGAUGUUCU

[0085] The gene-specific oligonucleotide probe sequences designed above were synthesized by chemical synthesis method, and uracil in the probe sequences was labeled with biotin (bio-U) during the synthesis process.

[0086] 1.2 Oligonucleotide probe labeling kit and in situ hybridization detection re...

Embodiment 3

[0151] Example 3, Overexpression of BART6-3p inhibits growth, proliferation, invasion and metastasis of tumor cells

[0152] 1. Material method

[0153] 1.1 Cell culture and transfection

[0154] EBV-negative nasopharyngeal carcinoma cell lines 5-8F and HNE2, and gastric cancer cell AGS were purchased from the Cell Center of Central South University. The RPMI1640 medium and fetal bovine serum used for cell culture, and the trypsin used for digesting cells were all products of Gibco, USA.

[0155] BART6-3p is synthesized by Invitrogen Company through chemical synthesis, and the sequence is:

[0156] CGGGGAUCGGACUAGCCUUAGA

[0157] Tumor cell lines with good growth status were divided into 2×10 5 Cells / well were seeded in a 6-well plate, and the 6-well plate was placed at 37°C, 5% CO 2 In the incubator, the transfection of BART6-3p can be started when the cells to be cultured grow to a density of 50-70%; the transfection process is as follows:

[0158] Add 8 μl of Hiperfect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of EB virus encoded microRNA BART6-3p in preparation of a nasopharyngeal carcinoma cell inhibitor. The microRNA BART6-3p is used for preparing a preparation for inhibiting growth and reproduction of nasopharyngeal carcinoma cells and preventing tumor cell invasion and metastasis. The microRNA BART6-3p has a sequence of CGGGGAUCGGACUAGCCUUAGA. The microRNA BART6-3p is further used for preparing a preparation for assembling and reconstructing a nasopharyngeal carcinoma cell inhibition framework. The microRNA BART6-3p provides a powerful molecular biological tool to assistant treatment of nasopharyngeal carcinoma, and has far-reaching clinical magnificence and important popularization application prospect.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and in particular relates to a method for preparing an inhibitor of nasopharyngeal carcinoma cells by using microRNABART6-3p encoded by Epstein-Barr virus. Background technique [0002] Epstein-Barrvirus (EBV) is a ubiquitous human herpes virus that can infect about 95% of the adult population in the world. Except for a small number of people who occasionally cause infectious mononucleosis, most of the infected people There will not be any clinical symptoms, and EBV can remain latent in the host for a long time in most cases. However, latently infected EBV can lead to malignant tumors in some cases, including B-cell-derived Burkitt and Hodgkin's lymphoma, and epithelial-derived nasopharyngeal and gastric carcinomas. The mechanism of EBV leading to malignant tumors is not yet fully understood. It may be related to the expression of a series of genes encoded by EBV itself. For example, laten...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K31/7088A61P35/00
Inventor 曾朝阳何宝玉李桂源熊炜李小玲李夏雨张文玲石磊向波龚朝建陈攀廖前进
Owner CENT SOUTH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap