Recombinant escherichia coli and application in fermenting and producing 2Fe2S ferredoxin
A technology of recombinant Escherichia coli, Escherichia coli, applied in fermentation, microorganism-based methods, bacteria and other directions, can solve the problems of low activity, low expression, large time, etc., and achieve the effect of saving cost and time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1: Construction of recombinant Escherichia coli that highly expresses [2Fe2S]-type ferredoxin in Agrobacterium tumefaciensS33
[0037] Agrobacterium tumefaciensS33 cells were taken, and genomic DNA was extracted from Agrobacterium tumefaciensS33 cells according to the method recommended by the bacterial genomic DNA extraction kit.
[0038] According to the known [2Fe2S] type ferredoxin gene sequence in the S33 genome of Agrobacterium tumefaciens (Agrobacterium tumefaciens) as shown in SEQ ID NO.1, the primers were designed as follows:
[0039] F primer: 5'CGCGGATCCGATGACAAAACTGACAATCGTTGC3'
[0040] R primer: 5'CCCAAGCTTTCAGCCCTGGCGCTCAGGAAC3'
[0041] The extracted Agrobacterium tumefaciens S33 genomic DNA was used as a template for PCR amplification to obtain [2Fe2S] type ferredoxin gene. The PCR reaction system is as follows:
[0042]
[0043]
[0044] The PCR reaction conditions are:
[0045] 95℃5min
[0046] 95°C for 30s, 55°C for 30s, 72°C for 30s...
Embodiment 2
[0055] Embodiment 2: the application of recombinant escherichia coli highly expressed [2Fe2S] ferredoxin
[0056] (1) Inoculate the recombinant Escherichia coli strain constructed in Example 1 into the TB medium containing antibiotics and iron-sulfur sources with an inoculum size of 1% by volume, and cultivate it at 37°C and 180rpm for 2 to 3 hours to OD 620nm is 0.6, the bacterial liquid is obtained;
[0057] Among them, the formula and final concentration of components of the above TB medium are: Tryptone12g / L, Yeastextract24g / L, Glycerol4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;
[0058] The above-mentioned antibiotics are chloramphenicol with a final concentration of 25 μg / ml, tetracycline with a final concentration of 10 μg / ml, and ampicillin with a final concentration of 100 μg / ml;
[0059] The formula and final concentration of the above-mentioned iron and sulfur sources are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine 0.1-0.2g / L, ferric citrate 0.18-0.3g / L, ...
Embodiment 3
[0063] Example 3: Separation, purification and activity determination of [2Fe2S]ferredoxin.
[0064] The purification of protein was carried out in an anaerobic operation box, and all solutions used were degassed and anaerobic treated after boiling.
[0065] Prepare the buffer required for purification: buffer A: sodium phosphate 20mM, NaCl0.5M, pH7.4; buffer B: sodium phosphate 20mM, NaCl0.5M, imidazole 250mM, pH7.4; the formula of buffer C is: Sodium phosphate 50mM, pH7.0; the formula of buffer D is: sodium phosphate 50mM, 1M NaCl, pH7.0; the formula of buffer W is: sodium phosphate 50mM, pH7.4.
[0066] Acquisition of crude enzyme solution: resuspend the frozen cells prepared in Example 2 with buffer A containing 10% glycerol, and use an ultrasonic disruptor to disrupt the cells. The cell disruption procedure is: working time 6 seconds, intermittent time 6 seconds , power 39%, total crushing time is 50 minutes. After the crushing is completed, centrifuge at 12,000 rpm for...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com