Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant escherichia coli and application in fermenting and producing 2Fe2S ferredoxin

A technology of recombinant Escherichia coli, Escherichia coli, applied in fermentation, microorganism-based methods, bacteria and other directions, can solve the problems of low activity, low expression, large time, etc., and achieve the effect of saving cost and time

Inactive Publication Date: 2016-02-17
SHANDONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, only the [2Fe2S] type ferredoxin from spinach is commercially sold. However, due to species differences, this ferredoxin shows different efficiencies when analyzing enzymes from other species, and the protein is very expensive , which largely limits the application of ferredoxin and scientists' research on ferredoxin-related enzymes and metabolic processes
[0003] In the existing literature reports, most ferredoxins are purified from wild bacteria and other organisms, and are also prepared by heterologous expression, but these methods have many shortcomings, such as consuming a lot of time and cumbersome purification steps , low expression, incomplete iron-sulfur cluster assembly of ferredoxin and low activity, low final yield and purity, etc.
Based on this, the research and development of methods capable of efficiently expressing [2Fe2S] ferredoxin has become an urgent problem to be solved. After searching, there are related recombinant Escherichia coli that can efficiently express [2Fe2S] ferredoxin and its production of [2Fe2S ] The application of ferredoxin has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli and application in fermenting and producing 2Fe2S ferredoxin
  • Recombinant escherichia coli and application in fermenting and producing 2Fe2S ferredoxin
  • Recombinant escherichia coli and application in fermenting and producing 2Fe2S ferredoxin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Construction of recombinant Escherichia coli that highly expresses [2Fe2S]-type ferredoxin in Agrobacterium tumefaciensS33

[0037] Agrobacterium tumefaciensS33 cells were taken, and genomic DNA was extracted from Agrobacterium tumefaciensS33 cells according to the method recommended by the bacterial genomic DNA extraction kit.

[0038] According to the known [2Fe2S] type ferredoxin gene sequence in the S33 genome of Agrobacterium tumefaciens (Agrobacterium tumefaciens) as shown in SEQ ID NO.1, the primers were designed as follows:

[0039] F primer: 5'CGCGGATCCGATGACAAAACTGACAATCGTTGC3'

[0040] R primer: 5'CCCAAGCTTTCAGCCCTGGCGCTCAGGAAC3'

[0041] The extracted Agrobacterium tumefaciens S33 genomic DNA was used as a template for PCR amplification to obtain [2Fe2S] type ferredoxin gene. The PCR reaction system is as follows:

[0042]

[0043]

[0044] The PCR reaction conditions are:

[0045] 95℃5min

[0046] 95°C for 30s, 55°C for 30s, 72°C for 30s...

Embodiment 2

[0055] Embodiment 2: the application of recombinant escherichia coli highly expressed [2Fe2S] ferredoxin

[0056] (1) Inoculate the recombinant Escherichia coli strain constructed in Example 1 into the TB medium containing antibiotics and iron-sulfur sources with an inoculum size of 1% by volume, and cultivate it at 37°C and 180rpm for 2 to 3 hours to OD 620nm is 0.6, the bacterial liquid is obtained;

[0057] Among them, the formula and final concentration of components of the above TB medium are: Tryptone12g / L, Yeastextract24g / L, Glycerol4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;

[0058] The above-mentioned antibiotics are chloramphenicol with a final concentration of 25 μg / ml, tetracycline with a final concentration of 10 μg / ml, and ampicillin with a final concentration of 100 μg / ml;

[0059] The formula and final concentration of the above-mentioned iron and sulfur sources are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine ​​0.1-0.2g / L, ferric citrate 0.18-0.3g / L, ...

Embodiment 3

[0063] Example 3: Separation, purification and activity determination of [2Fe2S]ferredoxin.

[0064] The purification of protein was carried out in an anaerobic operation box, and all solutions used were degassed and anaerobic treated after boiling.

[0065] Prepare the buffer required for purification: buffer A: sodium phosphate 20mM, NaCl0.5M, pH7.4; buffer B: sodium phosphate 20mM, NaCl0.5M, imidazole 250mM, pH7.4; the formula of buffer C is: Sodium phosphate 50mM, pH7.0; the formula of buffer D is: sodium phosphate 50mM, 1M NaCl, pH7.0; the formula of buffer W is: sodium phosphate 50mM, pH7.4.

[0066] Acquisition of crude enzyme solution: resuspend the frozen cells prepared in Example 2 with buffer A containing 10% glycerol, and use an ultrasonic disruptor to disrupt the cells. The cell disruption procedure is: working time 6 seconds, intermittent time 6 seconds , power 39%, total crushing time is 50 minutes. After the crushing is completed, centrifuge at 12,000 rpm for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant Escherichia coli, which is named as Escherichia coli pCodonPlus / pRKISC / pETDuet-S33[2Fe2S]Fd, the strain contains [2Fe2S] ferredoxin genes sourced from agrobacterium tumefaciens S33, and a nucleotide sequence thereof is shown as SEQ ID NO.1; the recombinant Escherichia coli is obtained by inoculating the [2Fe2S] ferredoxin into a pETDuet-1 carrier to prepare recombinant plasmids named as pETDuet-[2Fe2S] and transferring the prepared recombinant plasmids into Escherichia coli C41(DE3) containing pCodonPlus and pRKISC plasmids. The invention also discloses an application of the recombinant Escherichia coli in fermenting and producing [2Fe2S] ferredoxin. The experiment proves that 23mg of pure [2Fe2S] ferredoxin can be obtained from every liter of fermented culture, which is far higher than the reported yield 0.03mg of [2Fe2S] purified from wild mushrooms, so that the recombinant Escherichia coli has good application prospect in the industrialized production.

Description

technical field [0001] The invention relates to genetically recombined engineering bacteria and applications thereof, in particular to a recombinant Escherichia coli for fermentative production of [2Fe2S] ferredoxin and applications thereof. Background technique [0002] Ferredoxin is a kind of acidic protein containing iron-sulfur clusters, and the iron-sulfur clusters are mainly divided into [4Fe4S], [2Fe2S], [3Fe4S] and other types. As a common electron carrier, ferredoxin participates in important metabolic processes such as respiration, photosynthesis, and fermentation. At present, only the [2Fe2S] type ferredoxin from spinach is sold commercially. However, due to species differences, this ferredoxin shows different efficiencies when analyzing enzymes from other species, and the protein is very expensive , which largely limits the application of ferredoxin and scientists' research on ferredoxin-related enzymes and metabolic processes. [0003] In the existing literatu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12P21/02C12R1/19
Inventor 王书宁黄海燕胡烈杰于文君李慧俐袁恒星
Owner SHANDONG UNIV