Unlock instant, AI-driven research and patent intelligence for your innovation.

Water type NADH oxidase of reproducible coenzyme NAD+ and encoding gene and application thereof

A technology of oxidase coding and oxidase, applied in the fields of oxidoreductase, application, genetic engineering, etc., to achieve mild reaction conditions, easy amplification, and environmental friendliness

Inactive Publication Date: 2016-02-17
TAIYUAN UNIV OF TECH
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there have been many research reports on NOX from different sources in foreign countries, but the H that can be applied to industrial production 2 There are still relatively few O-type NADH oxidases, so more new types of highly active H 2 O-type NADH oxidase is very necessary, and there are still relatively few domestic researches on this type of enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Water type NADH oxidase of reproducible coenzyme NAD+ and encoding gene and application thereof
  • Water type NADH oxidase of reproducible coenzyme NAD+ and encoding gene and application thereof
  • Water type NADH oxidase of reproducible coenzyme NAD+ and encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0034] Experimental example 1 Screening and analysis of NADH oxidase gene

[0035] Through screening and analysis of the NCBI gene database, it was determined that the protein gene sequence in the Lactobacilluspentosus ATCC8041 genome with high homology with the Lactobacillus brevis NADH oxidase was the candidate research object, and the gene sequence is shown in SEQIDNO.2.

experiment example 2

[0036] Experimental Example 2 Construction of recombinant expression vectors pET28a-LpNox and pET28a-GlyDH

[0037] Design primers according to gene sequence (LpNox gene and GlyDH gene), the upstream primer of LpNox gene is CGC GGATCC ATGAAAGTTATCGTAATTGGTTGTACTCAT, the downstream primer is CCG CTCGAG TTATTCCGTCACTTTTTCAGCCGC; the upstream primer of GlyDH gene is CGC GGATCC ATGGACCGCATTATTCAATCACCGG, the downstream primer is CCG CTCGAG TTATTCCCACTCTTGCAGGAAACGC, the primers were synthesized by Shenggong Bioengineering (Shanghai) Co., Ltd. The underlined part is the BamHI and XhoI restriction sites. The LpNox gene and GlyDH gene were amplified by PCR using Lactobacillus pentosus genome and E. coli genome as templates. Agarose gel electrophoresis results showed that the amplified gene size was consistent with the theoretical value. The recovered LpNox gene, GlyDH gene and pET28a were digested with restriction enzymes BamHI and XhoI in a 37°C water bath for 2 hours. The purifi...

experiment example 3

[0039] Experimental example 3 Expression and purification of E. coli recombinant LpNox

[0040] The medium used in culturing the recombinant expression transformant can be any medium conventional in the art that can grow the transformant and produce LpNox of the present invention. For E. coli inoculation, LB medium is preferred, and TB is preferred for expansion. Medium. The culture method and culture conditions are not particularly limited, and can be selected according to the host type and culture method and other factors according to common knowledge in the field, as long as the transformant can grow and produce the LpNox of the present invention. Other specific operations for culturing transformants can be performed according to conventional operations in the field.

[0041] For Escherichia coli strains, the present invention selects the following method: inoculate the strain constructed in Example 2 into LB medium containing Kana, culture at 37°C at 180r shaking for 8 hours, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to NADH oxidase in the field of biotechnology and particularly provides water type NADH oxidase of reproducible coenzyme NAD+ and an encoding gene and application thereof. The oxidase is represented by an amino acid sequence shown as SEQ ID NO.1. By the adoption of the water type NADH oxidase, 1,3-dihydroxyacetone can be produced through in-vitro serial connection and glycerin conversion of the oxidase and glycerol dehydrogenase. Compared with a chemical method for preparing the 1,3-dihydroxyacetone, the method has the advantages of being moderate in reaction condition, friendly to environment, simple in operation, easy to amplify and the like.

Description

Technical field [0001] The invention belongs to NADH oxidase in the field of biotechnology, specifically a renewable coenzyme NAD + Water-type NADH oxidase and its coding gene and application. The oxidase can utilize O 2 As a substrate to oxidize NADH to NAD + , While generating by-product H 2 O. Background technique [0002] As oxidoreductases have shown more and more important roles in the biocatalytic preparation of chiral alcohols, chiral ketones, hydroxy acids, amino acids, etc., they have shown a wide range of uses in the fields of pharmacy, food, fine chemicals, and pesticides. The research on this type of enzyme has also become one of the hotspots of current research. However, the oxidoreductase needs to consume a certain amount of coenzyme during the reaction. About 80% of the oxidoreductase’s coenzyme is nicotinamide adenine dinucleotide (NAD + / NADH), so that the demand for such coenzymes in industry and scientific research has increased dramatically. However, the pri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12P7/26
CPCC12N9/0036C12P7/26C12Y106/03001
Inventor 张建栋范晓军崔智美张照昱武华磊
Owner TAIYUAN UNIV OF TECH