Water type NADH oxidase of reproducible coenzyme NAD+ and encoding gene and application thereof
A technology of oxidase coding and oxidase, applied in the fields of oxidoreductase, application, genetic engineering, etc., to achieve mild reaction conditions, easy amplification, and environmental friendliness
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0034] Experimental example 1 Screening and analysis of NADH oxidase gene
[0035] Through screening and analysis of the NCBI gene database, it was determined that the protein gene sequence in the Lactobacilluspentosus ATCC8041 genome with high homology with the Lactobacillus brevis NADH oxidase was the candidate research object, and the gene sequence is shown in SEQIDNO.2.
experiment example 2
[0036] Experimental Example 2 Construction of recombinant expression vectors pET28a-LpNox and pET28a-GlyDH
[0037] Design primers according to gene sequence (LpNox gene and GlyDH gene), the upstream primer of LpNox gene is CGC GGATCC ATGAAAGTTATCGTAATTGGTTGTACTCAT, the downstream primer is CCG CTCGAG TTATTCCGTCACTTTTTCAGCCGC; the upstream primer of GlyDH gene is CGC GGATCC ATGGACCGCATTATTCAATCACCGG, the downstream primer is CCG CTCGAG TTATTCCCACTCTTGCAGGAAACGC, the primers were synthesized by Shenggong Bioengineering (Shanghai) Co., Ltd. The underlined part is the BamHI and XhoI restriction sites. The LpNox gene and GlyDH gene were amplified by PCR using Lactobacillus pentosus genome and E. coli genome as templates. Agarose gel electrophoresis results showed that the amplified gene size was consistent with the theoretical value. The recovered LpNox gene, GlyDH gene and pET28a were digested with restriction enzymes BamHI and XhoI in a 37°C water bath for 2 hours. The purifi...
experiment example 3
[0039] Experimental example 3 Expression and purification of E. coli recombinant LpNox
[0040] The medium used in culturing the recombinant expression transformant can be any medium conventional in the art that can grow the transformant and produce LpNox of the present invention. For E. coli inoculation, LB medium is preferred, and TB is preferred for expansion. Medium. The culture method and culture conditions are not particularly limited, and can be selected according to the host type and culture method and other factors according to common knowledge in the field, as long as the transformant can grow and produce the LpNox of the present invention. Other specific operations for culturing transformants can be performed according to conventional operations in the field.
[0041] For Escherichia coli strains, the present invention selects the following method: inoculate the strain constructed in Example 2 into LB medium containing Kana, culture at 37°C at 180r shaking for 8 hours, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 