Detection method for CALR (Calreticulin) gene deletion and insertion mutation and kit

An insertion mutation and gene deletion technology, applied in the field of biomedical testing, can solve problems such as CALR gene deletion and lack of diagnostic molecular markers

Inactive Publication Date: 2016-03-30
DIASYS DIAGNOSTIC SYST SHANGHAI
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Notably, approximately 40% of JAK2 and MPL negative essential thrombocythemia (ET) or primary myelofibrosis (PMF) still lack definitive diagnostic molecular markers
In 2013, Dr. Thorsten and other two research groups found from the WGS data analysis that JAK2 and MPL wild-type ET or PMF patients had repetitive insertions or deletions of the CALR gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method for CALR (Calreticulin) gene deletion and insertion mutation and kit
  • Detection method for CALR (Calreticulin) gene deletion and insertion mutation and kit
  • Detection method for CALR (Calreticulin) gene deletion and insertion mutation and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0118] Verify the method of the present invention with positive plasmid sample

[0119] In this example, the method of the present invention was used to perform PCR detection on each positive known CALR genotype plasmid, and it was verified that the reaction system of this method can identify the wild type, insertion mutation and / or deletion mutation of CALR at one time through multiple reactions in a single tube. Each reaction contained the wild-type, deletion or insertion mutation-positive plasmids of the exon region of CALR9, and the positive plasmids of each CALR genotype were prepared individually or in combination as samples to be tested (plasmid concentration was 10 3 copies / μL).

Embodiment approach

[0121] 1. Prepare standard positive plasmids for each genotype of CALR

[0122] 1.1. Primer design: Design primers according to the reported exon 9 sequence of the human CALR gene:

[0123] Upstream primer 5'-3' sequence: CTGGTCCTGGTCCTGATGTCG

[0124] Downstream primer 5'-3' sequence: TCTTCCTCCTTGTCCTCCTCA

[0125] 1.2. Use the following PCR reaction system to clone the CALR exon 9 mutation region:

[0126] Add the following PCR system as shown in Table-2 into the 50 μL micro-PCR reaction tube:

[0127] Table 2

[0128]

[0129]

[0130] Add sterilized deionized water to a final volume of 50 μl.

[0131] The reaction conditions were total denaturation at 94°C for 5 minutes, 40 cycles (94°C for 30 seconds, 54°C for 1 minute, 72°C for 1 minute), and 72°C for 10 minutes.

[0132] 1.3.PCR product cloning: the amplified PCR fragment was recovered by the PCR product recovery kit, blunt-ended with T4DNA polymerase (T4DNApolymerase, NEBBioLabs company), and then subjected ...

Embodiment 2

[0149] Confirmatory testing of the method of the invention with known CALR genotype blood samples

[0150] The present invention verifies and measures known CALR genotype blood samples

[0151] In this example, for the serum samples with known CALR genotypes after sequencing, PCR verification was performed using the kit of the present invention. This example further proves that this kit is suitable for the identification and detection of the insertion and deletion mutations of exon 9 of the CALR gene in the human serum genome, and is suitable for the diagnosis of MPN related to human CALR.

[0152] 1. Implementation method:

[0153] 1. After labeling the blood samples (27 cases in total) with known CALR gene sequences to be tested, take 150-500 μL of blood, extract DNA with QIAGEN or other corresponding company blood DNA extraction kits, and measure the 260nm O.D. value , and dilute it to a concentration of approximately 5-10 ng / μL.

[0154] 2. The real-time PCR reaction sy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection method for deletion and insertion mutation of L367fs*46 (c.1179-1230del) and K385fs*4(c.1234-1235insTTGTC) of the ninth exon of a CALR (Calreticulin) gene. Universal amplification primers are designed according to deletion and insertion mutation areas of the ninth exon of the CALR gene, specific detection fluorescence probes are designed according to amplified fragments, real-time fluorescence quantification PCR (polymerase chain reaction) is performed on a to-be-detected sample, and deletion and insertion mutation of the CALR gene are identified through multiple single-tube reactions. The invention further provides applications of the universal amplification primers and the specific detection fluorescence probes in preparation of myeloproliferative neoplasm detection reagents as well as a kit for detecting myeloproliferative neoplasms.

Description

technical field [0001] The invention belongs to the technical field of biomedical detection, and relates to a detection method for calreticulin (CARL) gene deletion and insertion mutation, in particular to a detection method based on exon 9 of the CARL gene (exon9) L367fs*46 (c.1179 -1230del), K385fs*4 (c.1234-1235insTTGTC) deletion and insertion mutation nucleic acid real-time fluorescent PCR detection method. Background technique [0002] Myeloproliferative neoplasms (Myeloproliferative neoplasms, MPN) is a group of tumor diseases characterized by excessive proliferation of hematopoietic stem cells, granulocyte system, erythrocyte system, megakaryocyte system and mast cells. Generally, MPN includes: Chronic myelogenous leukemia (CML), polycythemia vera (PV), essential thrombocythemia (Essential thrombocythemia, ET), primary myelofibrosis (Primarymyelofibrosis, PMF) , chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia non-idiosyncratic (Chroniceosiophilicle...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6886C12Q2600/156C12Q2600/16C12Q2537/143C12Q2561/101C12Q2561/113
Inventor王荣芳关明钱震斌施长根吴之源陈昊
OwnerDIASYS DIAGNOSTIC SYST SHANGHAI