Recombinant vector for eliminating activity of kanamycin drug resistance gene and building method of recombinant vector

A recombinant vector, kanamycin technology, applied in the field of pathogenic bacteriology, can solve the problem of bacteria having kanamycin resistance and achieve the effect of eliminating drug-resistant bacteria, important market value, good social and economic value

Inactive Publication Date: 2016-04-06
YANGZHOU UNIV
View PDF3 Cites 41 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0015] The purpose of the present invention is to construct a gRNA recombinant vector that eliminates the activity of the kanamycin-resistant gene, so as to eliminate the drug-resistant bacteria in the organism and solve the problem that the bacteria have kanamycin resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vector for eliminating activity of kanamycin drug resistance gene and building method of recombinant vector
  • Recombinant vector for eliminating activity of kanamycin drug resistance gene and building method of recombinant vector
  • Recombinant vector for eliminating activity of kanamycin drug resistance gene and building method of recombinant vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 is the construction method of the recombinant vectors pCas9ΔCam-KR58 and pCas9ΔCam-KR208.

[0039]1. Design of kan gene-specific gRNA:

[0040] pET28a is a commonly used commercial molecular cloning vector. The kan gene sequence in pET28a was directly selected for gRNA target scanning, and 75 potential gRNA sequence target sites were obtained. Following the principle of reducing the off-target probability as much as possible and enhancing the binding affinity with the target gene as much as possible, through the off-target analysis of the host bacterial genome for these potential sites, several gRNA sequences with low off-target probability and high affinity binding to the target gene were selected, and after subsequent experiments The research verified that two gRNA sequences with ideal degrading kan gene activity were identified, named KR58 and KR208 respectively, and their specific nucleotide sequences were as follows:

[0041] KR58: GCCGCGATTAAATTCCAACA ...

Embodiment 2

[0068] Example 2 is one of the application examples of the recombinant vectors pCas9ΔCam-KR58 and pCas9ΔCam-KR208: suppressing the kanamycin resistance of recipient bacteria through transformation. In nature, there is a phenomenon that recipient bacteria directly absorb DNA in the environment, that is, transformation phenomenon.

[0069] When pCas9△Cam-KR58 and pCas9△Cam-KR208 are respectively transformed into Escherichia coli containing pET28a, the specific steps are as follows: first, prepare competent cells of Escherichia coli containing pET-28a; then, take 1 μL of the recombinant vector Add 100 μL of competent cells, mix well, place on ice for 30 minutes, heat shock at 42°C for 75 seconds, place on ice again for 3 minutes, add 800 μL of LB to the centrifuge tube, mix well, place in a shaker at 37°C, shake at 160rpm for 1 hour Then, draw about 50 μL of the bacterial solution and spread it on the LB agar plate, place it upright in a 37°C incubator for 30 minutes, and after t...

Embodiment 3

[0075] Example 3 is the second application example of the recombinant vectors pCas9ΔCam-KR58 and pCas9ΔCam-KR208: inhibition of kanamycin resistance of recipient bacteria through conjugation. In nature, there is a phenomenon of transferring DNA between bacteria through sex pili, that is, the phenomenon of conjugation.

[0076]When pCas9△Cam-KR58 and pCas9△Cam-KR208 were respectively introduced into attenuated Salmonella as donor bacteria, it prepared attenuated Salmonella competent cells, and the recombinant vector transformation and screening methods were the same as the transformed Escherichia coli in Example 2 The competent states were the same, and the conjugation experiments were carried out with Escherichia coli containing pET28a as the recipient bacteria, that is, the attenuated Salmonella containing the recombinant vector and the Escherichia coli containing pET-28a were co-incubated at 37°C for 8 hours, and the Count on LB plates containing antibiotics and kanamycin, r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant vector for eliminating the activity of a kanamycin drug resistance gene, and aims at eliminating drug resistance germs in organisms and solving the problem of kanamycin drug resistance of the germs. The recombinant vector for eliminating the activity of the kanamycin drug resistance gene is characterized by comprising a pCas9 vector subjected to chloramphenicol resistance elimination and a gRNA nucleotide sequence KR58 or KR208 aiming at a kanamycin resistance gene kan; the concrete nucleotide sequence of the KR58 is GCCGCGAT TAAATTCCAACA, and the concrete nucleotide sequence of the KR208 is CAATGATG TTACAGATGAGA. A building method of the recombinant vector mainly comprises the steps of carrying intergenic region nucleic acids by a novel gene editing tool CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas9 system; removing a chloramphenicol resistance gene on the recombinant vector; transforming the gene into vaccine vector bacteria such as attenuated salmonella typhimurium; performing co-culture on the recombinant bacteria and the kanamycin drug resistance gene so that the recombinant vector in the recombinant bacterium cell enters the kanamycin drug resistance bacteria in an engaging mode. The activity of the kanamycin resistance gene kan is effectively inhibited, so that the original drug resistance bacterium cannot grow on a kanamycin culture medium.

Description

technical field [0001] The invention relates to the field of pathogenic bacteriology, in particular to a gRNA recombinant vector for eliminating drug resistance gene activity and a construction method thereof. Background technique [0002] With the widespread use of antibiotics, bacterial resistance is becoming more and more serious. Kanamycin belongs to aminoglycoside antibiotics and is effective against Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli and Proteus. Clinically, it is mainly used for urinary tract infection, respiratory tract and lung infection caused by sensitive bacteria, especially drug-resistant Pseudomonas aeruginosa. A variety of bacteria, including Escherichia coli, contain kanamycin resistance genes. [0003] The elimination of drug-resistant bacteria is an important method to solve bacterial drug resistance. Drug-resistant bacteria in the environment can be sterilized by physical or chemical methods. However, drug-resistant bacteri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/66
CPCC12N15/63C12N15/66C12N2800/101C12N2810/10
Inventor李国才徐桐桐卞晓锐单彩龙赵丹焦红梅
OwnerYANGZHOU UNIV