Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for rapid screening of single copy transgenic offspring homozygous family and use thereof

A transgenic, single-copy technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of heavy workload, accelerated breeding process, and long time consumption, and achieve heavy workload, accelerated breeding process, and time-consuming long-term effect

Inactive Publication Date: 2016-07-27
HUAZHONG AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The invention can solve the main defects of existing methods for screening homozygous plants, such as long time-consuming and heavy workload, and speed up the breeding process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapid screening of single copy transgenic offspring homozygous family and use thereof
  • Method for rapid screening of single copy transgenic offspring homozygous family and use thereof
  • Method for rapid screening of single copy transgenic offspring homozygous family and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Agrobacterium-mediated genetic transformation

[0035] The Agrobacterium-mediated genetic transformation method mainly refers to the method shown in the "Agrobacterium-mediated Genetic Transformation Operation Manual" published by the State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University (Lin Yongjun et al., Agrobacterium-mediated Mudanjiang No. 8 high-efficiency Establishment of transgenic system, Acta Crops Sinica, 2002, 28(3): 294-300). The transformation recipient was embryogenic callus induced from mature seeds of rice variety Zhonghua 11 (Institute of Crop Science, Chinese Academy of Agricultural Sciences). The hygromycin-resistant callus is obtained after precultivation, infection, co-cultivation, water washing and screening, and then undergoes differentiation, rooting, seedling training and transplanting to obtain transgenic plants. The main steps of the genetic transformation of the present invention, the culture medium ...

Embodiment 2

[0141] Embodiment 2: Extraction of rice sample genomic DNA

[0142] Take an appropriate amount of transgenic rice (there is no requirement for the variety, the present embodiment uses the transgenic Zhonghua 11, the original variety of Zhonghua 11 comes from the Institute of Crop Science, China Academy of Agriculture) T1 generation of young leaves of plants, through a fully automatic milling machine (Tissuelyser- 48, Shanghai Jingxin Industrial Development Co., Ltd.) After grinding, discard the steel balls, add 800μl 1.5×CTAB extract (15gCTAB; 75ml1MTris-HCl, pH8.0; 30ml0.5MEDTA, pH8.0; 61.4gNaCl to a constant volume of 1l, stir 65℃ water bath for 30min; add 600μl chloroform / isoamyl alcohol (volume ratio 24:1) and turn it upside down several times (about 15min), until the lower liquid phase turns dark green; centrifuge at 12000r / min for 10min at room temperature ;Take 500μl of supernatant in a new 1.5ml centrifuge tube, add 1ml of pre-cooled 95% ethanol, mix well and place at ...

Embodiment 3

[0143] Embodiment 3: real-timePCR analysis

[0144] The Real-timePCR reaction kit was used for real-timePCR analysis (the reaction kit was purchased from Treasure Bioengineering Dalian Co., Ltd., PremixExTaq TM Reagent test kit). The primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd. (Hn-F: CTGATAGAGTTGGTCAAGAC, Hn-R: TACATGGCGTGATTTCATAT; G3PDH-F: TTACATCTCTAGTCTCTTATG, G3PDH-R: CTGGAACATTTTATCTACCTA (Table 1), dissolved to a concentration of 100 μM, using Pre-dilute 50 times to 2μM. The reaction system is: DNA, 2.4μl, the amount is about 50ng; 2XSYBRbuffer (plus 50XROXReference0.2μl), 5.2μl; left and right primers 1.2μl, the reaction system is 10μl. The reaction program is 94 ° C 10sec ; 94°C for 5 sec, 60°C for 34 sec, 45 cycles. After the reaction is completed, do a solubility curve to detect the specificity of the amplification. The solubility curve shows that the amplification product is a single peak, indicating that the primer is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant transgenosis and relates to a method for rapid screening of a single copy transgenic offspring homozygous family and a use thereof. A carrier is conversed through an agrobacterium-mediated genetic transformation method, a positive single copy transgenic plant is screened through southern, seeds of the T0 generation of the transgenic plant are collected and then are sowed in a seed bed, leaves in a trefoil stage are collected, total DNAs of a hand sample are extracted through a CTAB method, real-time PCR primers are designed according to an exogenous target gene hygromycin and an endogenous G3PDH gene, the hand sample DNA is subjected to real-time PCR through the primers of the exogenous target gene and the endogenous gene, amplification Ct values of the exogenous target gene and the endogenous gene are calculated and compared, a transgenic plant genotype is determined through the amplification Ct values, after the T1 generation of the plants produce fruits, a transgenic plant genotype is detected through germination, the above two transgenic plant genotypes are compared, and the two materials with the identical genotypes are used as transgenic breeding, hybridization transformation breeding or polygene pyramiding breeding materials.

Description

technical field [0001] The invention belongs to the field of plant transgenic technology, and specifically relates to a method and application for rapidly screening homozygous families of single-copy transgenic offspring, and the application includes rice transgenic breeding, hybrid transgenic breeding or multi-gene aggregation breeding. Background technique [0002] Rice is the most important food crop in my country, feeding about 60% of the population in China. Since the first transgenic time occurred in 1983 (Zambryski et al., Tipplasmid vector for the introduction of DNA in plant cells without alteration of their normal regeneration capacity. EMBOJ, 1983, 2: 2143-2150), the research on plant genetic engineering has made rapid progress and has become an important method in the process of modern crop breeding And technology. Improving crops through genetic engineering has good application prospects in agricultural production; therefore, transgenic technology will also pla...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 林拥军陈太钰
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More