Method for rapid screening of single copy transgenic offspring homozygous family and use thereof
A transgenic, single-copy technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of heavy workload, accelerated breeding process, and long time consumption, and achieve heavy workload, accelerated breeding process, and time-consuming long-term effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Agrobacterium-mediated genetic transformation
[0035] The Agrobacterium-mediated genetic transformation method mainly refers to the method shown in the "Agrobacterium-mediated Genetic Transformation Operation Manual" published by the State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University (Lin Yongjun et al., Agrobacterium-mediated Mudanjiang No. 8 high-efficiency Establishment of transgenic system, Acta Crops Sinica, 2002, 28(3): 294-300). The transformation recipient was embryogenic callus induced from mature seeds of rice variety Zhonghua 11 (Institute of Crop Science, Chinese Academy of Agricultural Sciences). The hygromycin-resistant callus is obtained after precultivation, infection, co-cultivation, water washing and screening, and then undergoes differentiation, rooting, seedling training and transplanting to obtain transgenic plants. The main steps of the genetic transformation of the present invention, the culture medium ...
Embodiment 2
[0141] Embodiment 2: Extraction of rice sample genomic DNA
[0142] Take an appropriate amount of transgenic rice (there is no requirement for the variety, the present embodiment uses the transgenic Zhonghua 11, the original variety of Zhonghua 11 comes from the Institute of Crop Science, China Academy of Agriculture) T1 generation of young leaves of plants, through a fully automatic milling machine (Tissuelyser- 48, Shanghai Jingxin Industrial Development Co., Ltd.) After grinding, discard the steel balls, add 800μl 1.5×CTAB extract (15gCTAB; 75ml1MTris-HCl, pH8.0; 30ml0.5MEDTA, pH8.0; 61.4gNaCl to a constant volume of 1l, stir 65℃ water bath for 30min; add 600μl chloroform / isoamyl alcohol (volume ratio 24:1) and turn it upside down several times (about 15min), until the lower liquid phase turns dark green; centrifuge at 12000r / min for 10min at room temperature ;Take 500μl of supernatant in a new 1.5ml centrifuge tube, add 1ml of pre-cooled 95% ethanol, mix well and place at ...
Embodiment 3
[0143] Embodiment 3: real-timePCR analysis
[0144] The Real-timePCR reaction kit was used for real-timePCR analysis (the reaction kit was purchased from Treasure Bioengineering Dalian Co., Ltd., PremixExTaq TM Reagent test kit). The primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd. (Hn-F: CTGATAGAGTTGGTCAAGAC, Hn-R: TACATGGCGTGATTTCATAT; G3PDH-F: TTACATCTCTAGTCTCTTATG, G3PDH-R: CTGGAACATTTTATCTACCTA (Table 1), dissolved to a concentration of 100 μM, using Pre-dilute 50 times to 2μM. The reaction system is: DNA, 2.4μl, the amount is about 50ng; 2XSYBRbuffer (plus 50XROXReference0.2μl), 5.2μl; left and right primers 1.2μl, the reaction system is 10μl. The reaction program is 94 ° C 10sec ; 94°C for 5 sec, 60°C for 34 sec, 45 cycles. After the reaction is completed, do a solubility curve to detect the specificity of the amplification. The solubility curve shows that the amplification product is a single peak, indicating that the primer is...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap