Isoprene Synthase Gene and Its Application
A technology for isoprene and isoprene production, applied in the field of isoprene synthase gene and its application, can solve the problem of low efficiency of isoprene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1: Obtaining of gene fragments
[0028] 1. Extraction of total RNA from weeping willow leaves
[0029] Collect weeping willow leaves, use RNeasy Plant Mini Kit (Qiagen company) to extract the total RNA of weeping willow leaves, carry out according to the kit instructions, and carry out electrophoresis ( figure 1 ) to verify the quality of RNA extraction, it can be seen that the integrity of the RNA is good, and subsequent experiments can be performed.
[0030] 2. RT-PCR
[0031] Take Oligo(dT) 20 As a reverse transcription primer, the nucleic acid was reverse transcribed into cDNA according to the instructions of the reverse transcription kit SuperScript. III First-Strand Synthesis System for RT-PCR (Invitrogen);
[0032] The reaction system is as follows:
[0033] RNA 1 μg
[0034] 10mM dNTP 1μl
[0035] Oligo(dT)20 (0.5μg / μl) 1μl
[0036] 65°C for 5min, place on ice for 1min, add the following 10μl mix
[0037]
[0038] 50°C for 50min, 85°C for 1...
Embodiment 2
[0056] Example 2: Obtaining the full length of the coding region of the SbIspS gene
[0057] The method for obtaining full-length cDNA is SMARTer-RACE, using PCR cDNA SynthesisKit (Clontech Company) was carried out, and the primers and reagents used below were all except GSP Provided in the PCR cDNASynthesis Kit, follow the kit instructions.
[0058] 1. Preparation of RACE-Ready cDNA
[0059] The reverse transcription system for the first strand of RACE-Ready cDNA is as follows:
[0060]
[0061] 2. Design of gene-specific primers:
[0062] Design gene-specific primers (GSP) according to the sequence of the obtained SbIspS fragment, use RACE-Ready cDNA as a template, and use GSP and universal primer (Universal Primer Mix, UPM) as primers for amplification, and 3'-RACE cDNA fragments and 5'-RACE cDNA fragments can be obtained. '-RACE cDNA fragment. Primer position as Image 6 As shown, the black part in the middle is the sequence obtained by degenerate PCR, the bla...
Embodiment 3
[0083] Embodiment 3: Construction of Escherichia coli isoprene production strain
[0084] The sequences of the full-length primers CLFa and CLRa are as follows:
[0085] CLFa: 5'GTCATGCCATGGGGTGTTCTGTAAGCACAA 3'
[0086] CLRa: 5'CATATGGTACCTTATCTCTCAACAGGTAGA 3'
[0087] 1. Construction of Escherichia coli expression vector pBAD-SbIspS
[0088] The SbIspS gene fragment obtained using primers CLFa and CLRa was subjected to NcoI and KpnI (TAKARA Company) double enzyme digestion, and the pBAD-HisB expression vector (purchased from Invitrogen Company) was subjected to NcoI and KpnI double enzyme digestion, and the SbIspS gene was connected to pBAD- The HisB vector was transformed into trans5α competent cells, and positive clones were selected for sequencing. The nucleotide sequence of pBAD-SbIspS is SEQ ID No.5.
[0089] 2. Construction of isoprene-producing strain MV / pSbIspS
[0090] The constructed pBAD-SbIspS and plasmids p1 and p2 were co-transformed into the BW25113 host ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More