Method for expressing protein in geotrichum candidum resting spores
A technology of Geotrichum candidum spores and dormant spores, which is applied in the biological field, can solve the problems of non-application, and achieve the effect of eliminating cathode effect, avoiding killing cells, and improving cell survival rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Expression of green fluorescent protein (GFP) in Geotrichum candidum cells:
[0067] 1. Plasmid construction
[0068] Using the GFP gene coding sequence, the GFP gene is shown in SEQ ID NO.5,
[0069] The protein sequence of the above GFP gene is shown in SEQ ID NO.6,
[0070] PCR primers for amplifying the GFP gene:
[0071] F: AGAT GCTAGC GTGAGCAAGGGC wavy line is Aat II restriction site
[0072] R: ACGC GTC GAC TTACTTGTACAGCTCGT The wavy line is the Sal I restriction site
[0073] The underlined GCTAGC sequence in primer F is used to promote the binding of the translation initiation factor to RNA after the DNA is transcribed into RNA, and this sequence is adjacent to the initiation codon ATG of the expressed target gene. After using the above pair of primers for PCR, GCTAGC can be carried upstream of the GFP gene, and restriction sites can be carried upstream and downstream.
[0074]
[0075] After agarose gel electrophoresis was used to detect that t...
Embodiment 2
[0105] Expression of red fluorescent protein (RFP) in Geotrichum candidum cells:
[0106] 1. Plasmid construction
[0107] The nucleic acid sequence of RFP is shown in SEQ ID NO.7,
[0108] The protein sequence of RFP is shown in SEQ ID NO.8,
[0109] The primers for amplifying the RFP gene are as follows:
[0110] Upstream primer: RFP-F:5'CGGAATTC GCCACC ATGGCCTCCTCCGAGGACGT 3'
[0111] Downstream primer: RFP-R: 5' TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'
[0112] The 5-end of the upstream primer has an EcoR I restriction site and an underlined GCCACC sequence, which is used to promote the transcription of the DNA into RNA, and the translation initiation factor binds to the RNA. This sequence is consistent with the start codon of the expressed target gene ATG is next door.
[0113] The 5-end of the downstream primer has a Sal I restriction site.
[0114] According to the method of Example 1, the RFP gene was amplified by PCR, molecularly cloned, connected to the pGEM-T easy vec...
Embodiment 3
[0130] Expression of yellow fluorescent protein (YFP) in Geotrichum candidum cells:
[0131] 1. Plasmid construction
[0132] The nucleic acid sequence of YFP is shown in SEQ ID NO.9,
[0133] The protein sequence of YFP is shown in SEQ ID NO.10,
[0134] Using the same primers as GFP in Example 1, and according to the same experimental steps and methods, the GFP gene was amplified by PCR, molecularly cloned, connected to the pGEM-T easy vector, and then transcribed in vitro, and the resulting RNA was transformed Host spores.
[0135] 2. Use the coding RNA of yellow fluorescent protein to express yellow fluorescent protein in dormant spores of Geotrichum candidum, the steps are as follows:
[0136] 1) Geotrichum candidum culture and spore collection
[0137] In a 15cm petri dish, prepare a solid agar medium (PDA medium), inoculate Geotrichum candidum CICC 32222 on the surface of the solid agar medium, and cultivate it for 3 days at a temperature of 40°C and a humidity of 6...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com