Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-diacetyl-yield Lactobacillus plantarum strain and application thereof

A technology of Lactobacillus plantarum and diacetyl, applied in the field of microbiology, can solve the problems of insufficient ability of lactic acid bacteria to produce diacetyl, and achieve remarkable technological progress, high yield and broad prospects

Inactive Publication Date: 2017-03-22
SHANGHAI INST OF TECH
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at the above-mentioned technical problems in the prior art, the present invention provides a high-yielding diacetyl-producing Lactobacillus plantarum and its application, and the described high-yielding diacetyl-producing Lactobacillus plantarum and its application will solve the problem of lactic acid bacteria in the prior art. Technical problem of insufficient ability to produce diacetyl

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-diacetyl-yield Lactobacillus plantarum strain and application thereof
  • High-diacetyl-yield Lactobacillus plantarum strain and application thereof
  • High-diacetyl-yield Lactobacillus plantarum strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] The collection and separation of embodiment 1 Lactobacillus plantarum CCTCC M 2016513

[0042] (1), sample pretreatment

[0043] Take several portions of 3g of Tibetan Linggu mushroom, put them into 50ml Erlenmeyer flasks filled with 15ml of sterile water respectively, after shaking, let stand for 20min, and set aside.

[0044] (2) Isolation of lactic acid bacteria strains

[0045] Use sterile water to serially dilute the above samples according to 1:10 by volume, take 0.1mL diluted samples at each dilution, spread the MRS agar plate and M17 agar plate respectively, and incubate at a constant temperature under anaerobic conditions at 37°C 24-48h, use a sterile toothpick to pick out a single colony with different sizes, raised, slightly white, moist, with neat edges, and the back of the colony is yellow. Then streak on the corresponding agar plate to obtain a pure single colony, carry out Gram staining, and contact enzyme experiment. The purified strains were preserve...

Embodiment 2

[0060] Example 2 Identification of Lactobacillus plantarum CCTCC M 2016513

[0061] (1) Physiological and biochemical tests

[0062] Strain CCTCC M 2016513 is a Gram-positive, peroxidase-negative, non-motile bacillus capable of growth at 15°C and 45°C.

[0063] (2) 16s rDNA sequence analysis of strain CCTCC M 2016513

[0064] Genomic DNA extraction method of strain CCTCC M 2016513: pick and inoculate a single colony of purified CCTCC M 2016513 into 10 mL of MRS liquid medium, culture at 37°C for 8 hours, and centrifuge the liquid (5000 g, 10 min) to collect the bacteria. Genomic DNA extraction kit (Sangon Bioengineering (Shanghai) Co., Ltd.) was used for extraction. PCR amplification using two synthetic universal primers

[0065] 16s 27F:GAGAGTTTGATCCTGGCTCAG

[0066] 16s 1492R: CGGCTACCTTGTTACGACTT

[0067] The PCR products were recovered with a column-type PCR product purification kit (Sangon Bioengineering (Shanghai) Co., Ltd.), purified and sent to Sangon Bioengineeri...

Embodiment 3

[0070] Growth characteristics of embodiment 3CCTCC M 2016513 strain

[0071] (1) Drawing of growth curve of CCTCC M 2016513 strain

[0072] Insert the activated Lactobacillus plantarum CCTCC M 2016513 into the MRS liquid medium according to the inoculum amount of 5% (v / v), cultivate it at a constant temperature of 37°C for 16h, measure the OD value of the culture solution at 600nm every 1-2h, and use OD The growth curve of strain CCTCC M 2016513 in MRS was obtained by plotting the value against time, and the results ( image 3 ) showed that: Lactobacillus plantarum CCTCC M 2016513 grew rapidly in the MRS medium, entered the logarithmic phase at about 2h, and entered the stationary phase at about 11h.

[0073] (2) Determination of the optimal growth temperature of CCTCC M 2016513 strain

[0074] Inoculate the activated Lactobacillus plantarum CCTCC M 2016513 into 10mL MRS liquid medium at 5% (V / V) inoculum, and place them at 15°C, 25°C, 32°C, 37°C, 40°C and 45°C Cultivate at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-diacetyl-yield Lactobacillus plantarum strain of which the collection number of the strain is CCTCC M2016513. The invention also discloses a working ferment which contains the Lactobacillus plantarum strain. The invention also discloses application of the high-diacetyl-yield Lactobacillus plantarum strain in fermented food. The detection and organoleptic evaluation on the diacetyl content in the Lactobacillus-plantarum-containing fermented milk indicate that the Lactobacillus plantarum has higher diacetyl yield and higher organoleptic scores, improves the fragrance quality of the fermented milk and promotes the enhancement of the fermented milk quality.

Description

technical field [0001] The invention belongs to the field of microbiology, and relates to a plant lactobacillus, specifically a high diacetyl-producing plant lactobacillus (Lactobacillus plantarum) and an application thereof. Background technique [0002] Lactic acid bacteria (LAB) is a general term for a class of bacteria that can use fermentable sugars to produce a large amount of lactic acid. There are at least 23 taxonomic genera of such bacteria that have been found in nature. The lactic acid bacteria that are widely used in the fields of food and medicine mainly include Lactobacillus, Streptococcus, Enterococcus, Lactococcus, Pediococcus and Leuconostoc. Lactic acid bacteria are the main source of probiotics. Many lactic acid bacteria are inherent probiotics in the human intestinal tract. They have important physiological activities such as improving the human intestinal flora, regulating the body's immunity, suppressing tumors, lowering serum cholesterol, and regulati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A23C9/123C12R1/25
CPCA23C9/1234C12N1/20C12N1/205C12R2001/25
Inventor 田怀香于海燕张燕陈臣卢艳青史雨桦钱新华
Owner SHANGHAI INST OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com