Preparation method of α-amylase

An amylase and gene technology, applied in the field of α-amylase preparation, can solve the problems of difficulty in obtaining pure products and cumbersome purification steps of α-amylase, and achieve the effect of good safety and simple purification operation

Active Publication Date: 2019-07-16
SHENZHEN INNOVATION CENT OF SMALL MOLECULE DRUG DISCOVERY CO LTD
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the above problems, the present invention provides a preparation method of α-amylase, which can solve the technical problems in the prior art that the preparation of α-amylase by Bacillus subtilis is cumbersome and difficult to obtain a pure product.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of α-amylase
  • Preparation method of α-amylase
  • Preparation method of α-amylase

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0022] Experimental Example 1 Preparation of α-amylase.

[0023] (1) Preparation of vector pxmj19-aph213.

[0024] The structure of the vector pxmj19-aph213 is as figure 1 As shown, its construction process is as follows:

[0025] The aph213 gene was amplified from the vector xk99e vector with primers aph213F and aph213R, and the primers used were as follows:

[0026] aph213F: ccggatatcagcttcacgctgccgcaagcac

[0027] aph213R: ccgaagcttaattctgtttcctgtgtgaaattg

[0028] The PCR conditions are as follows: 95°C for 4min; 35 cycles of 95°C for 30s, 62°C for 30s, and 72°C for 1min; 72°C for 7min.

[0029] The design of the above primers makes the aph213 gene amplification process form an EcoRV cut point upstream of the aph213 gene and a HindIII cut point downstream. Restriction digestion, T4 DNA ligase, and connection to the vector pxmj-19 that has also been digested by EcoRV and HindIII, to obtain the vector pxmj19-aph213.

[0030] The amplification process of the vector pxmj...

Embodiment 2

[0052] Example 2 Identification of alpha-amylases.

[0053] (1) SDS-PAGE identification.

[0054] Centrifuge the fermentation broth, take 10ul of the supernatant for SDS-PAGE, to detect the band size of the protein and the purity of the purification, the results are as follows figure 2 As shown, the results show that compared with the empty vector, the supernatant band with the recombinant α-amylase vector will have an extra band of about 68kD, and the purification result will also have a single band, such as figure 2 As shown, lane 5 is the purified α-amylase, lane 1 is the protein marker, lane 2 is the supernatant of Corynebacterium glutamicum, and lane 3 is the supernatant containing α-amylase that has not been adsorbed after being purified by a nickel column. Flow-through, lane 4 is the supernatant containing α-amylase.

[0055] (2) Identification by DNS method.

[0056] In the experimental group, add 50ul enzyme solution to 250ul pH5.0 citrate disodium hydrogen phosp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of Alpha-amylase. The preparation method can solve the technical problems that in the prior art, when the Alpha-amylase is prepared form bacillus subtilis, the later-period purification steps are complicated, and the pure product cannot be easily obtained. The method comprises the following steps of (2) adding an e3 SD sequence at the upstream of an Alpha-amylase gene, adding a histidine tag at the downstream part of the Alpha-amylase gene, and obtaining the modified Alpha-amylase gene; (3) connecting the modified Alpha-amylase gene onto a vector pxmj19-aph213, and obtaining a recombinant expression vector pxmj19-aph213-amy; (4) transferring the recombinant expression vector pxmj19-aph213-amy into corynebacterium glutamicum to obtain recombinant bacteria; (5) culturing the recombinant bacteria, and performing secretory expression on the Alpha-amylase; and (6) performing Alpha-amylase purification: performing affinity chromatography on supernatant containing the Alpha-amylase, wherein the medium is a nickel column.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a preparation method of α-amylase. Background technique [0002] α-amylase is an enzyme widely distributed in animals, plants and microorganisms, which can hydrolyze the α-1,4 glycosidic bonds of starch and glycogen to generate dextrin and reducing sugar. The carbon atom configuration is α configuration, so it is called α-amylase. [0003] Bacillus subtilis is one of the most widely used strains in the production of industrial enzyme preparations today. Research data show that Bacillus subtilis can produce more than ten kinds of enzymes such as α-amylase, β-glucanase, protease, cellulase, phytase, pectinase and xylanase, and the enzyme production is high , Good security. Therefore, some scientific research institutes and enterprises prepare α-amylase by Bacillus subtilis. Although this method has a high yield, the purification steps are cumbersome and it is not easy to obtain a pu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/28C12N15/77
CPCC12N9/2417C12N15/77C12N2800/101C12Y302/01001
Inventor刘秀霞张伟白仲虎杨艳坤李诗洁王世杰
OwnerSHENZHEN INNOVATION CENT OF SMALL MOLECULE DRUG DISCOVERY CO LTD