Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant plasmid pMDMcherry, construction method of recombinant plasmid and method for marking Edwardsiella ictaluri with red fluorescent protein gene

A red fluorescent protein, recombinant plasmid technology, applied in microorganism-based methods, recombinant DNA technology, biochemical equipment and methods, etc., to achieve the effects of reducing costs, high stability, and simple and intuitive methods

Inactive Publication Date: 2017-05-10
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are few domestic research reports on the pathogenic mechanism of Edwardsiella spp., and the research on the pathogenic mechanism of bacteria inevitably involves the relationship between the bacteria and the host. The use of marker genes is to monitor the growth, reproduction and interaction of bacteria in the host and the interaction with the host. effective means of acting

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant plasmid pMDMcherry, construction method of recombinant plasmid and method for marking Edwardsiella ictaluri with red fluorescent protein gene
  • Recombinant plasmid pMDMcherry, construction method of recombinant plasmid and method for marking Edwardsiella ictaluri with red fluorescent protein gene
  • Recombinant plasmid pMDMcherry, construction method of recombinant plasmid and method for marking Edwardsiella ictaluri with red fluorescent protein gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The construction method of embodiment 1 recombinant plasmid PMDMcherry

[0030] The construction method of the recombinant plasmid PMDMcherry of the present embodiment comprises the following steps:

[0031] (1) Preparation of promoter fragments:

[0032] Using the plasmid PRUAL as a template, ppS (SEQ ID No: 1) and ppA (SEQ ID No: 2) as upstream and downstream primers, the PCR reaction was carried out according to conventional methods, and the PCR products were subjected to 1% agarose electrophoresis with Gel Extraction Kit (day Root Biochemical Technology (Beijing) Co., Ltd.) for gel recovery to obtain the promoter fragment, the sequence number is SEQ ID No:3. The PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2:

[0033] ppS: 5'CGCCTAGGATACGCACACCGTGGAAAC3' (SEQ ID No: 1)

[0034] ppA: 5'CCTTGCTCACCATTTTTTCTTCCTCCA3' (SEQ ID No: 2)

[0035] Table 1 PCR amplification system

[0036]

[0037]

[0038] Table 2 PCR ...

Embodiment 2

[0050] Embodiment 2 The preparation method of red fluorescent protein gene marker Edwardsiella

[0051] The preparation method of the red fluorescent protein gene marker Edwardsiella of the present embodiment comprises the following steps:

[0052] (1) Using conventional operating methods, isolate the highly virulent strain of Edwardsiella spp. from the diseased zebrafish;

[0053] (2) Prepare the competent state of Edwardsiella spp.

[0054] Methods as below:

[0055] (a) Inoculate Edwardsiella sibriculi into BHI liquid medium, cultivate overnight at 28° C. on a shaker at 280 rpm;

[0056] (b) transfer to 500ml BHI liquid culture medium according to the amount of 1:500, 280rpm, 2.5-3.5h, cultivate until OD600 is 0.6;

[0057] (c) Immediately quench in an ice-water bath: You can choose to place a large container with ice-water mixture on a shaker and quickly rotate and shake to cool down the temperature of the culture as soon as possible;

[0058] (d) Centrifuge in a 250ml...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant plasmid pMDMcherry, a construction method of the recombinant plasmid and a method for marking Edwardsiella ictaluri with a red fluorescent protein gene. A base sequence of the recombinant plasmid pMDMcherry is shown as SEQ ID NO:7. The Edwardsiella ictaluri, in which a pMDMcherry recombinant vector is introduced, shows red fluorescence when observed under a fluorescence microscope. A stability test shows that a stability rate of the plasmid can reach 100% when the recombinant bacterium is transferred to the 25th generation. With the introduction of the red fluorescent protein gene, a simple and intuitive relation is provided for researching a relation between the Edwardsiella ictaluri and a host.

Description

technical field [0001] The invention belongs to the technical field of biological monitoring, and in particular relates to a recombinant plasmid pMDMcherry and a construction method thereof, and a method for marking Edwardsiella spp. with red fluorescent protein gene. Background technique [0002] Zebrafish is an emerging model animal developed in the past ten years. As a vertebrate, it has many advantages that mice cannot achieve: zebrafish is small in size, low in feeding and maintenance costs; short in reproductive cycle and large in egg production; more importantly, zebrafish embryos are fertilized in vitro , the developmental process can be directly and continuously observed. Zebrafish are increasingly favored by pathogenic microbiologists as infection models for infectious diseases. [0003] Edwardsiella is a bacterium belonging to the genus Edwardsiella in the Enterobacteriaceae family. In 1979, Hawke first discovered the infection of channel catfish by Edwardsiell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C12N15/65C12N1/21C12R1/01
CPCC12N15/74C07K14/43595C12N15/65
Inventor 刘春王芳李凯彬王庆曾伟伟石存斌
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More