cDNA specific molecular tag and application thereof

A technology of molecular labeling and specificity, applied in the biological field, can solve the problems of inaccuracy and the inability of biological information analysis data to truly reflect gene expression, and achieve the effect of improving accuracy

Active Publication Date: 2017-05-31
VAZYME BIOTECH NANJING
View PDF3 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is very challenging to determine the absolute quantitative abundance of different genes in two different species or in a single sample. Due to the bias of PCR amplification, the information reflected by the mRNA with different expression levels after subsequent PCR amplification of library construction Inaccurate, subsequent bioinformatics analysis data cannot truly reflect gene expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • cDNA specific molecular tag and application thereof
  • cDNA specific molecular tag and application thereof
  • cDNA specific molecular tag and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Design of specific molecular tags for cDNA

[0030] Specific molecular tags for cDNA include:

[0031] A. The universal primer sequence, as shown in SEQ ID NO.1, is used for subsequent PCR amplification of full-length cDNA. The specific sequence of the universal primer is as follows: AAGCAGTGGTATCAACGCAGAGTAC;

[0032] B. Transposase linker sequence P7, as shown in SEQ ID NO.2, the specific sequence is as follows: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG;

[0033] C. Random sequence (N) n , where N is a random sequence, a total of n;

[0034] D, poly(T) sequence, a total of 30 T bases, namely T30VN;

[0035] A cDNA molecular tag was synthesized by a gene synthesis method, and its nucleotide sequence is shown in SEQ ID NO.3: AAGCAGTGGTATCAACGCAGAGTAC GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG(N) n T30VN, wherein, N is a random sequence, a total of n, N is selected from A, T, C, G; preferably, n is 5-10.

Embodiment 2

[0036] Example 2 Preparation of full-length cDNA with the specific molecular tag

[0037] Human 293 cells were selected as the experimental material, and transcriptome amplification was performed using the Discover-sc WTA KitV2 (N711) kit from Vazyme. The reagents and materials used are provided by the kit, for example, single cell lysate, RNase Inhibitor, reverse transcription buffer, DTT, TSOligo, reverse transcriptase, high-fidelity enzyme, etc.

[0038] (1) Sample preparation

[0039] 1) Prepare 10×Sample Buffer in the following order, mix gently with a pipette, and collect by short centrifugation.

[0040] Table 1

[0041] components volume single cell lysate 19μl RNase Inhibitor 1μl total capacity 20μl

[0042] 2) Take 1 μl of 10×Sample Buffer into a 0.2ml PCR tube, then add 4 μl of nuclease-free pure water (Nuclease-free H 2 O).

[0043] 3) Isolation of single cells

[0044] Take the freshly cultured 293 cell suspension, collect...

Embodiment 3

[0069] Example 3 DNA library construction method using transposase

[0070] Use the (Vazyme) TruePrep DNA Library PrepKit V2 for Illumina (TD503) kit produced by Nanjing Nuoweizan Biotechnology Co., Ltd., and the reagents and materials used are all provided by the kit, for example, transposase buffer, PCR buffers, high-fidelity enzymes, and more.

[0071] The transposase and embedding buffer were provided by (Vazyme) Tn5Transposome (S111) kit produced by Nanjing Novizan Biotechnology Co., Ltd.

[0072] (1) Joint embedding

[0073] Configure the reaction system shown in Table 7, gently blow and mix with a pipette, place the prepared reaction system on a PCR instrument at 30°C for 1.5 hours to obtain the transposase embedding complex, and store at -20°C .

[0074] Table 7

[0075]

[0076]

[0077] (2) Fragmentation of full-length cDNA with molecular tags

[0078] 1) Add each reaction component shown in Table 8 in sequence to a sterilized PCR tube, and gently blow and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cDNA specific molecular tag and application thereof. The specific molecular tag comprises a universal primer sequence as shown in SEQ ID NO.1, a transposase joint sequence P7 as shown in SEQ ID NO.2, random sequences (N)n and a poly(T) sequence with 30 T alkalis, wherein N refers to the random sequences in a quantity of n, and a specific nucleotide sequence is as shown in SEQ ID NO.3. By application of the specific molecular tag to cDNA library construction, the specific molecular tag can be added to a 5' terminal of each cDNA to make each gene unique in a process of reverse transcription of RNA into full-length cDNA, and each gene in samples can be quantified according to sequences of the specific molecular tag in subsequent information analysis.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a specific molecular label of cDNA and its application. Background technique [0002] In the past two or three decades, the large-scale sequence analysis technology of next-generation sequencing has greatly promoted the sequence analysis of genome and transcriptome. Transcriptome sequencing has gradually replaced traditional gene expression profiling chips as the preferred transcriptome analysis solution because it does not require pre-designed probes for the entire transcriptome and can detect unknown transcripts. [0003] Transcriptome refers to all RNA transcribed by cells at a certain stage, including mRNA and non-coding RNA. Transcriptomics is the study of gene expression from the RNA level, and the study of gene transcription and transcriptional regulation in cells at the overall level. Different from the genome, the research of transcriptomics includes the limita...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/10C40B50/06
CPCC12N15/1096C12N15/11C40B50/06C12Q2525/191C12Q2525/173C12Q2531/113C12Q2521/107
Inventor曹林张力军聂俊伟齐心韩锦雄瞿志鹏张晨曦徐晓昱叶廷跃王丹凤刘辉辉
OwnerVAZYME BIOTECH NANJING