A molecular marker related to milk fat percentage of dairy goats and its application

A technology of molecular markers and dairy goats, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., to achieve the effect of less equipment, improved selection accuracy, and enriched molecular marker resource library

A technology of molecular markers and dairy goats, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., to achieve the effect of less equipment, improved selection accuracy, and enriched molecular marker resource library

CN106754909BInactive Publication Date: 2019-06-21青岛市畜牧兽医研究所

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker related to milk fat percentage of dairy goats and its application
  • A molecular marker related to milk fat percentage of dairy goats and its application
  • A molecular marker related to milk fat percentage of dairy goats and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Amplification of the SPARC Gene Partial Sequence of Laoshan Dairy Goat

[0042] 1. Primer design

[0043]Using the online primer design software Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) to the goat SPARC gene sequence (GeneBank accession number: NC_030814.1, sequence interval 47508621..47530930 ) was used as a template to design amplification primers containing partial sequences. The primers were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd. The DNA sequences of the primer pairs are as follows:

[0044] SPARCF4:CGAGGACAACAACCTCCTGAC

[0045] SPARCR4:CTAGGAGCCTCCAAAGGCCG

[0046] 2. Purification and sequencing of PCR products

[0047] PCR amplification reaction system 25 μL, including 1 μL of dairy goat peripheral blood genomic DNA (50ng / μL), 12.5 μL of 2×PCR Mix (Shanghai Sangon Bioengineering Co., Ltd.), 0.75 μL of forward primer SPARCF4 (10mM), 0.75 μL of reverse primer SPARCR4 (10 mM), 10 μL of ddH 2 O. The reaction...

Embodiment 2

[0054] Example 2 Genotyping

[0055] The R at the 142nd mutation site in the above sequence is A or G, and this mutation leads to BglII-RFLP polymorphism. The AA genotype produced two bands of 142bp and 101bp after digestion with BglⅡ, and the AG genotype produced three bands of 243bp, 142bp and 101bp after digestion with BglⅡ. The genotyping diagram is attached figure 2 shown.

Embodiment 3

[0056] Example 3 Association analysis of genotypes and traits of Laoshan dairy goat population

[0057] Select 200 Laoshan dairy goat ewes in lactation stage from Qingdao Aote sheep farm, take whole blood from jugular vein, extract genomic DNA, use primer pair SPARCF4, SPARCR4, carry out PCR amplification on dairy goat population DNA, use BglⅡ enzyme digestion Detect the genotype of each individual, and find that there are 132 AA genotype individuals (group 1), and the measured milk fat percentage average is 4.25% ± 0.29%; AG genotype individuals are 68 (group 2), and the milk fat percentage The mean is 3.67% ± 0.23%. Statistical analysis was performed on the data of Group 1 and Group 2 using one-way analysis of variance, and the obtained P value was 0.016 (<0.05). It was determined that there was a significant difference in the milk fat percentage between the AA genotype and the AG genotype. The dots can be used as molecular markers for dairy goat breeding.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of animal molecular marker preparation and specifically relates to a molecular marker related to the character of butter-fat content of milk goat and an application thereof. The molecular marker is acquired in the manner of cloning a goat SPARC gene; the sequence table of the nucleotide sequence is shown as SEQ ID NO.1; a G / A mutation is located at the No.142 locus basic group shown as the sequence table SEQ ID NO.1; Bgl II-RFLP polymorphism is caused by the mutation. The invention also discloses a preparation method for the molecular marker and an application of a polymorphism detection method. A new molecular marker is supplied for the marker auxiliary breeding of the milk goat.

Description

technical field [0001] The invention belongs to the technical field of animal molecular marker preparation, and in particular relates to the preparation and application of a molecular marker related to milk fat rate traits of dairy goats. Background technique [0002] my country is a country with a large number of dairy goats and a wide distribution. The dairy goat breeding industry used to be the leading industry of my country's dairy industry in the 1960s and 1980s. After the 1990s, it was affected by factors such as small breeding scale and rapid expansion of the dairy industry. The impact of dairy goat production slowed down. Over the past ten years, with the continuous improvement of people's living standards and the need for improved dietary structure, people's recognition of the nutritional value and safety of goat milk has changed, especially machine milking has solved the bottleneck problem of large-scale breeding , Promoted the revival and development of the nation...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
21 Jun 2019
Publication
CN106754909B
IPC
C12N15/11; C12Q1/6888
CPC
C12Q1/6888; C12Q2600/124; C12Q2600/156
Inventors
李和刚; 程明