A molecular marker related to milk fat percentage of dairy goats and its application
A technology of molecular markers and dairy goats, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., to achieve the effect of less equipment, improved selection accuracy, and enriched molecular marker resource library
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Amplification of the SPARC Gene Partial Sequence of Laoshan Dairy Goat
[0042] 1. Primer design
[0043]Using the online primer design software Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) to the goat SPARC gene sequence (GeneBank accession number: NC_030814.1, sequence interval 47508621..47530930 ) was used as a template to design amplification primers containing partial sequences. The primers were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd. The DNA sequences of the primer pairs are as follows:
[0044] SPARCF4:CGAGGACAACAACCTCCTGAC
[0045] SPARCR4:CTAGGAGCCTCCAAAGGCCG
[0046] 2. Purification and sequencing of PCR products
[0047] PCR amplification reaction system 25 μL, including 1 μL of dairy goat peripheral blood genomic DNA (50ng / μL), 12.5 μL of 2×PCR Mix (Shanghai Sangon Bioengineering Co., Ltd.), 0.75 μL of forward primer SPARCF4 (10mM), 0.75 μL of reverse primer SPARCR4 (10 mM), 10 μL of ddH 2 O. The reaction...
Embodiment 2
[0054] Example 2 Genotyping
[0055] The R at the 142nd mutation site in the above sequence is A or G, and this mutation leads to BglII-RFLP polymorphism. The AA genotype produced two bands of 142bp and 101bp after digestion with BglⅡ, and the AG genotype produced three bands of 243bp, 142bp and 101bp after digestion with BglⅡ. The genotyping diagram is attached figure 2 shown.
Embodiment 3
[0056] Example 3 Association analysis of genotypes and traits of Laoshan dairy goat population
[0057] Select 200 Laoshan dairy goat ewes in lactation stage from Qingdao Aote sheep farm, take whole blood from jugular vein, extract genomic DNA, use primer pair SPARCF4, SPARCR4, carry out PCR amplification on dairy goat population DNA, use BglⅡ enzyme digestion Detect the genotype of each individual, and find that there are 132 AA genotype individuals (group 1), and the measured milk fat percentage average is 4.25% ± 0.29%; AG genotype individuals are 68 (group 2), and the milk fat percentage The mean is 3.67% ± 0.23%. Statistical analysis was performed on the data of Group 1 and Group 2 using one-way analysis of variance, and the obtained P value was 0.016 (<0.05). It was determined that there was a significant difference in the milk fat percentage between the AA genotype and the AG genotype. The dots can be used as molecular markers for dairy goat breeding.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com