A gene regulating long-chain fatty acid transport in Candida tropicalis and its application

A technology of Candida tropicalis and long-chain fatty acids, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc.

Active Publication Date: 2020-04-24
QILU UNIV OF TECH
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Other LCFAs bind to cytoplasmic binding proteins or FABPs and are transported to sites where metabolism is required in the cell (Pohl et al., 2004), but no related transporters have been reported in C. tropicalis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene regulating long-chain fatty acid transport in Candida tropicalis and its application
  • A gene regulating long-chain fatty acid transport in Candida tropicalis and its application
  • A gene regulating long-chain fatty acid transport in Candida tropicalis and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Search and analysis of Candida tropicalis long-chain fatty acid gene

[0036] At present, there are very few studies on long-chain fatty acid transporters. It is known that there is only a special long-chain fatty acid transporter in Saccharomyces cerevisiae that is responsible for the transmembrane transport of long-chain fatty acids, while similar genes in Candida tropicalis have not been reported. Using the Saccharomyces cerevisiae fat1p gene as a template to query the NCBI database, it can be seen that there is a similar gene sequence in the genome of Candida tropicalis, its sequence is shown in SEQ ID NO.1, and the encoded protein has a sequence identity of 59.7% with that of Saccharomyces cerevisiae fat1p %, presumably related to long-chain fatty acid transport.

Embodiment 2

[0037] Example 2 Verification of Candida tropicalis fat1p gene function

[0038] 1. The construction method of Candida tropicalis genetically engineered recombinant bacteria, the steps are as follows:

[0039] (1) Extract the genomic DNA of Candida tropicalis (Candida tropicalis) thallus, and use the genomic DNA as a template to perform PCR amplification to obtain the homology arm Fat1p1 with a length of 551bp, such as figure 1 As shown, the PCR primer sequences are as follows:

[0040] Fat1p F 1 :G GAATTC AGACCAAGAAAGAATGCACCA;

[0041] Fat1p R 1 :CAACGGCCTCAACCCCAAGACATGATACCTGCT;

[0042] Wherein, the underline is marked as the EcoR I restriction site;

[0043] The PCR amplification system is 50 μl:

[0044] 2×HiFi-PCR master 25μl, primer Fat1p F at a concentration of 10μmol / L 1 2.5 μl, primer Fat1p R at a concentration of 10 μmol / L 1 2.5 μl, template 2.5 μl, with ddH 2 O make up 50 μl;

[0045] The PCR amplification procedure is as follows:

[0046] Pre-denatu...

Embodiment 3

[0099] On the basis of obtaining the full-length Fat1p gene, specific primers were designed to clone the target gene, and the vector and the target gene were configured into a recombination reaction system through seamless cloning technology to carry out the recombination reaction. Transform into DH5α competent medium, and screen positive clones. After the sequencing was correct, the extracted plasmid was electrotransformed into competent Candida tropicalis. Fermentation verification of the effect of increasing the copy number of Fat1p gene on the rate of cell oil absorption. The core of its technology is to use the principle of homologous recombination to linearize the vector, and introduce the terminal sequence of the linearized vector at the 5' end of the PCR primer of the insert fragment, so that the 5' and 3' ends of the PCR product are respectively equipped with the linearized vector Consistent sequences at both ends (15bp-20bp). After the PCR product with carrier end ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a gene that regulates long-chain fatty acid transport in Candida tropicalis and its application. The nucleotide sequence of the gene fat1p that regulates long-chain fatty acid transport in Candida tropicalis is shown in SEQ ID NO. 1. The amino acid sequence of the long-chain fatty acid transporter Fat1p is shown in SEQ ID NO. 2. The present invention discovered for the first time that the long-chain fatty acid transporter gene fat1p in Candida tropicalis is a key gene in the transmembrane transport process of long-chain fatty acids, and its expression can promote the transmembrane transport of long-chain fatty acids from extracellular to intracellular. It lays the foundation for realizing a new way to synthesize long-chain dibasic acids using oils and fats as raw materials.

Description

technical field [0001] The invention relates to a gene for regulating long-chain fatty acid transport of Candida tropicalis and its application, belonging to the technical field of bioengineering. Background technique [0002] Long-chain dibasic acids generally refer to straight-chain aliphatic dicarboxylic acids with more than 10 carbon atoms in the carbon chain. This product has high industrial application value and can be used to synthesize important chemical intermediates such as special nylon, high-grade musk, adhesive, hot melt adhesive, medicine, and pesticide. At present, there are two main methods for producing long-chain dibasic acids at home and abroad: chemical method and fermentation method. Compared with the microbial fermentation method, the production of long-chain dibasic acids by the chemical method has harsh conditions, complicated process, not environmentally friendly, and poor product quality. Therefore, many researchers have turned their targets to mic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/31C07K14/40C12P7/44C12R1/74
CPCC12P7/44C07K14/40Y02E50/10
Inventor王瑞明石莹汪俊卿杨晓慧程成彭健修翔
OwnerQILU UNIV OF TECH