Engineering bacteria for over-expressing phosphoglucomutase gene and uridine diphosphate glucose pyrophosphorylase gene and construction method

A technology of phosphorylase gene and glucose phosphate, which is applied in the fields of genetic engineering and microbial fermentation, can solve the problems of unclear regulation mechanism and low flocculation activity of polysaccharide flocculants, and achieves the effects of reducing cost, increasing yield and increasing yield.

Inactive Publication Date: 2017-07-04
XIAMEN UNIV
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The first purpose of the present invention is to provide overexpression of phosphoglucomutase gene pgcA and uridine diphosphate glucose pyrophosphorylase gene gtaB1 for the problems of low flocculation activity and unclear regulation mechanism of polysaccharide flocculants in the prior art.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria for over-expressing phosphoglucomutase gene and uridine diphosphate glucose pyrophosphorylase gene and construction method
  • Engineering bacteria for over-expressing phosphoglucomutase gene and uridine diphosphate glucose pyrophosphorylase gene and construction method
  • Engineering bacteria for over-expressing phosphoglucomutase gene and uridine diphosphate glucose pyrophosphorylase gene and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: the construction of recombinant expression vector PHY300-pgcA-gtaB1

[0029] Design PCR primers for amplifying the pgcA gene fragment.

[0030] The upstream and downstream primers are:

[0031] Upstream primer 1: GAGGAAAATCGGTACATGAGCTGGAGAACGAG

[0032] Downstream primer 2: GACTGCTTTTTTACTTTCATTCAATTTGAAGTCGCTTTTA

[0033] Design PCR primers for amplifying the gtaB1 gene fragment.

[0034] The upstream and downstream primers are:

[0035] Upstream primer 3: TAAAAGCGACTTCAAATTGAATGAAAGTAAAAAAAGCAGTC

[0036] Downstream primer 4: CTTTTCTTCTCGAGATCATTGCCATGCTCCTT

[0037] Using Bacillus licheniformis CGMCC 2876 genomic DNA as a template, perform the following PCR program: (1) 94°C, 5min; (2) 94°C, 30s; (3) 55°C, 30s; (4) 72°C, 1min, step (2) )~(4) Repeat 35 cycles; (5) 72°C, 10min, 4°C storage.

[0038] The PCR reaction system is shown in Table 1.

[0039] Table 1

[0040]

[0041] Primer 1 and primer 4 were used as upstream and downstream primer...

Embodiment 2

[0047] Embodiment 2: the construction of bacillus licheniformis genetically engineered bacteria HN301-5

[0048] After the PHY300-pgcA-gtaB1 overexpression plasmid was extracted and concentrated, it was transformed into Bacillus licheniformis by electric shock, recovered at 37°C for 5 hours, coated with a tetracycline-resistant plate, and cultured at 37°C for 12 hours to screen transformants. After the transformant was extracted from the plasmid, it was verified by PCR (such as figure 1 ). Thus, the Bacillus licheniformis engineering strain HN301-5 overexpressing the phosphoglucomutase gene pgcA and the uridine diphosphate glucose pyrophosphorylase gene gtaB1 was obtained.

[0049] The specific steps of electroconversion are as follows:

[0050] Preparation of Bacillus licheniformis competent:

[0051] (1) Inoculate a ring of B.licheniformis in 50mL LB medium, culture at 37°C, 200r / min overnight for 12h;

[0052] (2) Take 1 mL of the overnight culture solution and put it i...

Embodiment 3

[0061] Embodiment 3: Utilize Bacillus licheniformis and its genetically engineered bacteria fermentation to prepare polysaccharide flocculant

[0062] Bacillus licheniformis CGMCC 2876 starting strain and the genetically engineered bacterium described in Example 2 were inoculated in liquid seed culture medium, 37 ℃, 200r / min cultivated 16h, prepared seed culture liquid, with the inoculum size of 4% (V / V) Inoculate in the polysaccharide flocculant fermentation medium, culture at 37°C, 200r / min, and carry out the experiment of producing polysaccharide flocculant by fermentation. After 56 hours, the flocculation activity of the fermentation broth and the production of the polysaccharide flocculant (such as figure 2 ). The crude extraction yield of the polysaccharide flocculant of pgcA-gtaB1 tandem gene overexpression recombinant engineered bacteria was 9.07g / L, which was 20.77% higher than the original strain crude extraction yield of 7.51g / L.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Engineering bacteria for over-expressing a phosphoglucomutase gene and a uridine diphosphate glucose pyrophosphorylase gene and a construction method. The invention relates to gene engineering and microbial fermentation and discloses a strain of bacillus licheniformis, which simultaneously over-expressing a phosphoglucomutase gene (pgcA) and a UDP-glucose pyrophosphorylase gene (gtaB1), and the construction method thereof. In the method, the genes of the phosphoglucomutase and the UDP-glucose pyrophosphorylase, which are key enzymes in a synthesis route of a polysaccharide flocculating agent, are cloned, and a recombinant expression vector is constructed through escherichia coli-bacillus shuttle plasmid. Through an electrotransformation method, a recombinant plasmid is introduced into the bacillus licheniformis, thereby constructing a recombinant bacillus licheniformis strain HN301-5. The recombinant bacillus licheniformis is increased in yield of the polysaccharide flocculating agent by 20.77% than that of an original strain, and is hopeful to be applied in industrial production of the polysaccharide flocculating agent, thereby increasing yield and reducing cost.

Description

technical field [0001] The invention relates to genetic engineering and microbial fermentation, in particular to an engineering bacterium strain overexpressing phosphate glucose mutase gene and uridine diphosphate glucose pyrophosphorylase gene and a construction method. Background technique [0002] Phosphoglucomutase and uridine diphosphate glucose pyrophosphorylase (UDP-glucosepyrophosphorylase, UGPase) are widely distributed in plants, animals and bacteria, and closely related to glucose metabolism enzymes. The role of phosphoglucomutase is to convert glucose-6-phosphate to glucose-1-phosphate, which is a key step in the process of glucose metabolism. The uridine diphosphate glucose pyrophosphorylase catalyzed uridine diphosphate glucose (UDPG) is the main activated form of glucose, which can be used as a donor of glucose groups, and can be used as sucrose, starch, cellulose and hemicellulose in cells. , pectin and glycolipids, glycoproteins, glycogen, β-glucan and othe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/75C12N15/54C12N15/61C12P19/04C12R1/10
Inventor何宁刘沛泽陈震
OwnerXIAMEN UNIV