B cell screening method and application of B cell screening method in preparing monoclonal antibody

A monoclonal antibody and screening method technology, applied in the field of cell biology, can solve the problems of low success rate, time-consuming and laborious detection of fusion cell lines, etc., and achieve the effect of improving experimental efficiency.

Active Publication Date: 2017-08-18
SHENZHEN UNIV
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The technical problem to be solved by the present invention is: the detection of fusion cell lines in the preparation process of hybridoma cells is time-consuming and laborious, and the success rate is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • B cell screening method and application of B cell screening method in preparing monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0040] The present invention also provides an application of the above-mentioned B cell screening method in the preparation of monoclonal antibodies. The positive B cells screened in the above method are fused with myeloma cells for the preparation of monoclonal antibodies. The specific application process is a preparation method of a monoclonal antibody, including the following steps:

[0041] S21, adding a secreted and expressed signal peptide sequence to the N-terminus of the Protein A protein gene, and adding a transmembrane protein gene sequence to the C-terminus to obtain a fusion exogenous gene;

[0042] S22. Transfecting the fused exogenous gene into B cells that have been immunized as cells to be screened;

[0043] S23. Adding fluorescently labeled antigens to the cells to be screened, sorting and collecting the fluorescent cells using a flow cytometer to obtain positive B cells;

[0044] S24. Fusing the positive B cells with myeloma cells, and the resulting hybridoma ...

Embodiment 1

[0047] 1. Design primers to amplify the Protein A gene sequence. The two ends of the primers respectively have a secretion signal peptide and a transmembrane protein DNA fragment. At the same time, an enzyme cleavage site is introduced. The primers are designed as follows:

[0048] PROTEIN-BAMH I-F:

[0049] 5'-CCAGGATCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCGGCCAATGCTGCGCAACACGATGAA-3';

[0050] PROTEIN-XHOI-R:

[0051] 5'-CCGCTCGAGTCAGACACAGAGAAGATGCCTAGCCCAATGAAAAGCAGGAGGCCGGCGACGCCCCCCAGCACAATCAGGGCGCCCCCCAGCACAATCAG-3'.

[0052] A BamH I restriction site was introduced into the upstream primer, Xho I was introduced downstream, and the Protein A gene was amplified directly using Staphylococcus aureus liquid as a template.

[0053] 2. Construction of lentiviral expression plasmid

[0054] Constructed with the pLVX-puro lentiviral system, and simultaneously cut pLVX-puro and ProteinA with BamH I and Xho I to construct a pLVX-puro-Protein A len...

Embodiment 2

[0058] The preparation method of the complete monoclonal antibody of the present invention is illustrated by taking the preparation of human glycoprotein Tamm-Horsfall (THP) monoclonal antibody as an example.

[0059] 1. Synthetic amino acid sequence

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a B cell screening method and application of the B cell screening method in preparing a monoclonal antibody. The B cell screening method comprises the steps of S11, adding a signal peptide sequence of secretory expression at the N end of a Protein A protein gene, and adding a membrane-spanning gene sequence at the C end to obtain a fused exogenous gene; S12, using the fused exogenous gene to conduct transfection on a B cell of which immunity is completed, and adopting the B cell as a cell to be screened; S13, adding an antigen for labeling fluorescent into the cell to be screened, using a flow cytometry to sort and collect cell carrying fluorescent to obtain a positive B cell. According to the B cell screening method and application of the B cell screening method in preparing the monoclonal antibody, antibody molecules are gathered on the surface of the cell, through a fast and precise sorting function of the flow cytometry, a cell to be fused is screened in advance, thus the success rate and accuracy rate of a traditional mode are sharply increased, and the problem of detection of a monoclonal antibody cell strain in a later period is solved at the same time.

Description

technical field [0001] The invention belongs to the field of cell biology, and in particular relates to a B cell screening method and its application in the preparation of monoclonal antibodies. Background technique [0002] Monoclonal antibody is a highly uniform antibody produced by a single B cell clone that only targets a specific epitope. It is usually prepared by hybridoma technology. Hybridoma (hybridoma) antibody technology is based on cell fusion technology. Sensitized B cells with the ability to secrete specific antibodies and myeloma cells with the ability to multiply indefinitely are fused into B cell hybridomas. Using a single hybridoma cell with this characteristic to cultivate a cell population, a specific antibody against an antigenic epitope, that is, a monoclonal antibody, can be prepared. The preparation of hybridoma cells is a commonly used technique in the field of biology. The detection and identification of fused cell lines in conventional methods is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/62C12N15/867C07K16/00
CPCC07K14/31C07K16/00C07K2319/02C07K2319/03C12N15/86C12N2740/15043
Inventor易俊波周兆平买制刚刘立忠邹永东
OwnerSHENZHEN UNIV