Recombinant antigen composition for diagnosis of toxoplasma antibody and preparation method thereof

A technology of recombinant antigen and Toxoplasma gondii, which is applied in the field of genetic engineering technology and diagnostic reagents, can solve the problems of low detection rate, multiple components, false positives and other problems of detection methods, so as to improve the clinical detection rate, increase yield and specificity, Good specificity and sensitivity effects

Inactive Publication Date: 2017-08-29
WEIFANG HIGHTOP BIOTECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the antigens used for the detection of anti-toxoplasma antibodies are mostly Toxoplasma gondii extracts, SAG1 recombinant full-length, etc., but Toxoplasma gondii is divided into five different stages, namely trophozoites, cysts, schizonts, gametophytes and Oocysts, just a certain recombinant protein are likely to be missed, and the crude extract of Toxoplasma gondii can also lead to false positives due to its many components and complexity. Therefore, the detection rate of clinical pathogen detection methods is low. Diagnostic methods also have limitations in sensitivity and specificity, and screening highly sensitive and specific antigens is the key to developing a diagnostic kit for toxoplasmosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] A recombinant antigen composition for diagnosing Toxoplasma gondii antibody, the recombinant antigen composition comprises Toxoplasma gondii SAG1 specific epitope recombinant antigen, Toxoplasma gondii SAG3 specific epitope recombinant antigen, Toxoplasma gondii GRA3 specific epitope recombinant antigen and Toxoplasma gondii MIC3 specific Epitope recombinant antigen.

[0037] Wherein SAG1-specific epitope recombinant antigen, SAG3-specific epitope recombinant antigen, GRA3-specific epitope recombinant antigen and MIC3-specific epitope recombinant antigen in the recombinant antigen composition according to 1-5:1-5:1-5:1 -5 scale combination.

[0038] The specific epitope of the SAG1-specific epitope recombinant antigen is from the 48th to the 316th amino acid of the N-terminal of the SAG1 protein; the specific epitope of the SAG3-specific epitope recombinant antigen is from the 41st to 382th amino acid of the N-terminal of the SAG3 protein; The specific epitope of the GRA...

Embodiment 2

[0040] A method for preparing a recombinant antigen composition for diagnosing Toxoplasma gondii antibody, comprising the following steps:

[0041] (1) Screening of antigenic epitopes

[0042] Using online analysis tools, the full-length amino acid sequences of Toxoplasma gondii SAG1, SAG3, GRA3 and MIC3 were analyzed, and the specific antigen of Toxoplasma gondii SAG1 protein was screened from the 48th amino acid to the 316th amino acid; the specific antigen of Toxoplasma gondii SAG3 protein was located at the 41 amino acids to the 382nd amino acid; Toxoplasma gondii GRA3 protein specific antigen is located from the 44th amino acid to the 160th amino acid; Toxoplasma gondii MIC3 protein specific antigen is located from the 38th amino acid to the 383rd amino acid;

[0043] (2) Gene cloning of Toxoplasma gondii SAG1, SAG3, GRA3 and MIC3 protein epitopes

[0044] Design primers on both sides of the SAG1 epitope DNA sequence;

[0045] Upstream primer SAG1P1: 5'-TCGAACCCACCACTTG...

Embodiment 3

[0064] Example 3 Sequencing of recombinant plasmids of positive expression bacteria

[0065] The plasmids extracted from the above-mentioned positive expression bacteria were sent to Shanghai Sangon for sequencing.

[0066] The DNA sequence of the SAG1 gene fragment in the recombinant plasmid is completely correct, and the results are as follows:

[0067]TCGGATCCCCCTCTTGTTGCCAATCAAGTTGTCACCTGCCCAGATAAAAAATCGACAGCCGCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCAAGTGCCCTAAAACAGCGCTCACAGAGCCTCCCACTCTTGCGTACTCACCCAACAGGCAAATCTGCCCAGCGGGTACTACAAGTAGCTGTACATCAAAGGCTGTAACATTGAGCTCCTTGATTCCTGAAGCAGAAGATAGCTGGTGGACGGGGGATTCTGCTAGTCTCGACACGGCAGGCATCAAACTCACAGTTCCAATCGAGAAGTTCCCCGTGACAACGCAGACGTTTGTGGTCGGTTGCATCAAGGGAGACGACGCACAGAGTTGTATGGTCACAGTGACAGTACAAGCCAGAGCCTCATCGGTCGTCAATAATGTCGCAAGGTGCTCCTACGGTGCAGACAGCACTCTTGGTCCTGTCAAGTTGTCTGCGGAAGGACCCACTACAATGACCCTCGTGTGCGGGAAAGATGGAGTCAAAGTTCCTCAAGACAACAATCAGTACTGTTCCGGGACGACGCTGACTGGTTGCAACGAGAAATCGTTCAAAGATATTTTGCCAAAATTAACTGAGAACCCGTGGCAGGGTAACGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological detection, and particularly provides a recombinant antigen composition for diagnosis of toxoplasma antibody. The recombinant antigen composition comprises a toxoplasma SAG1 specific epitope recombinant antigen, a toxoplasma SAG3 specific epitope recombinant antigen, a toxoplasma GRA3 specific epitope recombinant antigen and a toxoplasma MIC3 specific epitope recombinant antigen. The invention further provides a preparation method of the recombinant antigen composition. The recombinant antigen composition has high specificity and sensitivity and is used for diagnosis of the toxoplasma antibody, clinical positive rate is increased greatly, and the problems of false positive and leaking detection during detection are solved effectively.

Description

technical field [0001] The invention relates to the fields of genetic engineering technology and diagnostic reagents, in particular to a recombinant antigen composition for diagnosing toxoplasma gondii antibody and a preparation method thereof. Background technique [0002] Toxoplasma gondii (Toxoplasma gondii) is an intracellular parasitic protozoa, the ultimate host is cats, but can reproduce in any warm-blooded animal. The worm is distributed worldwide, parasitic in human and mammalian tissue cells, and can cause severe zoonotic diseases. [0003] Toxoplasmosis can cause miscarriage, premature birth, recurrent miscarriage and teratogenicity, and even stillbirth in pregnant women. Even if the infection survives, 85% of infants will have retinal choroiditis and central nervous system abnormalities before adulthood, which will greatly affect prenatal and postnatal care. Therefore, the diagnosis of toxoplasmosis is a very important item in prenatal and postnatal care inspect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/45C12N15/30C12N15/70
CPCC07K14/45C12N15/70
Inventor杨致亭杨勤德李桂芹王爱法高立峰王婷
OwnerWEIFANG HIGHTOP BIOTECH