Recombinant antigen composition for diagnosis of toxoplasma antibody and preparation method thereof
A technology of recombinant antigen and Toxoplasma gondii, which is applied in the field of genetic engineering technology and diagnostic reagents, can solve the problems of low detection rate, multiple components, false positives and other problems of detection methods, so as to improve the clinical detection rate, increase yield and specificity, Good specificity and sensitivity effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0036] A recombinant antigen composition for diagnosing Toxoplasma gondii antibody, the recombinant antigen composition comprises Toxoplasma gondii SAG1 specific epitope recombinant antigen, Toxoplasma gondii SAG3 specific epitope recombinant antigen, Toxoplasma gondii GRA3 specific epitope recombinant antigen and Toxoplasma gondii MIC3 specific Epitope recombinant antigen.
[0037] Wherein SAG1-specific epitope recombinant antigen, SAG3-specific epitope recombinant antigen, GRA3-specific epitope recombinant antigen and MIC3-specific epitope recombinant antigen in the recombinant antigen composition according to 1-5:1-5:1-5:1 -5 scale combination.
[0038] The specific epitope of the SAG1-specific epitope recombinant antigen is from the 48th to the 316th amino acid of the N-terminal of the SAG1 protein; the specific epitope of the SAG3-specific epitope recombinant antigen is from the 41st to 382th amino acid of the N-terminal of the SAG3 protein; The specific epitope of the GRA...
Embodiment 2
[0040] A method for preparing a recombinant antigen composition for diagnosing Toxoplasma gondii antibody, comprising the following steps:
[0041] (1) Screening of antigenic epitopes
[0042] Using online analysis tools, the full-length amino acid sequences of Toxoplasma gondii SAG1, SAG3, GRA3 and MIC3 were analyzed, and the specific antigen of Toxoplasma gondii SAG1 protein was screened from the 48th amino acid to the 316th amino acid; the specific antigen of Toxoplasma gondii SAG3 protein was located at the 41 amino acids to the 382nd amino acid; Toxoplasma gondii GRA3 protein specific antigen is located from the 44th amino acid to the 160th amino acid; Toxoplasma gondii MIC3 protein specific antigen is located from the 38th amino acid to the 383rd amino acid;
[0043] (2) Gene cloning of Toxoplasma gondii SAG1, SAG3, GRA3 and MIC3 protein epitopes
[0044] Design primers on both sides of the SAG1 epitope DNA sequence;
[0045] Upstream primer SAG1P1: 5'-TCGAACCCACCACTTG...
Embodiment 3
[0064] Example 3 Sequencing of recombinant plasmids of positive expression bacteria
[0065] The plasmids extracted from the above-mentioned positive expression bacteria were sent to Shanghai Sangon for sequencing.
[0066] The DNA sequence of the SAG1 gene fragment in the recombinant plasmid is completely correct, and the results are as follows:
[0067]TCGGATCCCCCTCTTGTTGCCAATCAAGTTGTCACCTGCCCAGATAAAAAATCGACAGCCGCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCAAGTGCCCTAAAACAGCGCTCACAGAGCCTCCCACTCTTGCGTACTCACCCAACAGGCAAATCTGCCCAGCGGGTACTACAAGTAGCTGTACATCAAAGGCTGTAACATTGAGCTCCTTGATTCCTGAAGCAGAAGATAGCTGGTGGACGGGGGATTCTGCTAGTCTCGACACGGCAGGCATCAAACTCACAGTTCCAATCGAGAAGTTCCCCGTGACAACGCAGACGTTTGTGGTCGGTTGCATCAAGGGAGACGACGCACAGAGTTGTATGGTCACAGTGACAGTACAAGCCAGAGCCTCATCGGTCGTCAATAATGTCGCAAGGTGCTCCTACGGTGCAGACAGCACTCTTGGTCCTGTCAAGTTGTCTGCGGAAGGACCCACTACAATGACCCTCGTGTGCGGGAAAGATGGAGTCAAAGTTCCTCAAGACAACAATCAGTACTGTTCCGGGACGACGCTGACTGGTTGCAACGAGAAATCGTTCAAAGATATTTTGCCAAAATTAACTGAGAACCCGTGGCAGGGTAACGC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More