Unlock instant, AI-driven research and patent intelligence for your innovation.

PL-LbCpf1-RVR gene for recognizing specific sites in rice gene targeting and application thereof

A gene targeting and specific site technology, applied in the field of biotechnology and plant genetic engineering, can solve the problems of no established theory or method, limited number of LbCpf1 genes, etc.

Inactive Publication Date: 2017-08-29
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there is no general and feasible method to increase the number of LbCpf1 editable sites and ensure the mutation efficiency of LbCpf1 gene in crop gene targeting, and the number of existing LbCpf1 genes with high mutation efficiency is limited
Therefore, it is urgently desired to provide more LbCpf1 genes that provide more editing sites in crop gene targeting, but such genes are often unavailable, and there is no established theory or method for people to find them. Such genes provide theoretical basis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PL-LbCpf1-RVR gene for recognizing specific sites in rice gene targeting and application thereof
  • PL-LbCpf1-RVR gene for recognizing specific sites in rice gene targeting and application thereof
  • PL-LbCpf1-RVR gene for recognizing specific sites in rice gene targeting and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1——The acquisition of PL-LbCpf1-RVR gene

[0035] The inventors of the present application tried to transform the LbCpf1-RVR gene from Escherichia coli in various ways, unexpectedly obtained a new DNA sequence, and added a rice-preferred stop codon TGA to the end of the DNA sequence to form A new gene, the gene is named as PL-LbCpf1-RVR, the sequence is shown in SEQ ID NO: 1, see the sequence comparison with LbCpf1-RVR figure 1 .

[0036] Further analysis of its base composition, the results are shown in Table 2. It is known from Table 2 that the GC content of PL-LbCpf1 is as high as 53.06%, significantly higher than that of LbCpf1 which is 50.09%. In this way, the gene structure is more stable, because 3 hydrogen bonds can be formed between GC and 2 between AT.

[0037] Table 2 Gene base composition analysis of PL-LbCpf1-RVR and LbCpf1-RVR.

[0038]

[0039] Analysis-RVR The protein amino acid sequence encoded by LbCpf1-RVR and LbCpf1-RVR genes, the ...

Embodiment 2

[0041] Example 2—Construction of Plant Targeting Vector Containing PL-LbCpf1-RVR Gene

[0042] From Escherichia coli XL-blue containing the PUC57-AMP-PL-LbCpf1-RVR vector, use the Axygen plasmid extraction kit to extract the plasmid, digest with NotI / SacI, and recover the PL-LbCpf1-RVR fragment. At the same time, NotI / SacI enzyme was used to linearize pHUN600, recover pHUN600, and connect the above-mentioned PL-LbCpf1-RVR fragment and pHUN600 fragment with T4 ligase (purchased from TaKaRa Company) to obtain the plant expression vector pHUN600-PL-LbCpf1 -RVR( image 3 ), named pHUN 6b11.

[0043] Select the nucleotide sequence of position 6370-6398 in rice DL gene (LOCOs03g0215200) TATC AAAGCTGCCAAGCCAGATATCCCTCACAG, (the underlined part is the TATC part in the 5'TATV-(N)X-3' structure), as the targeting site. The target site sequence was fused to pHUN6b11 to form pHUN6b11-DL. The plant expression vector was transformed into Agrobacterium tumefaciens EHA105 strain (preserv...

Embodiment 3

[0044] Example 3—the genetic transformation of rice using pHUN6b11-DL as a targeting vector and the acquisition of mutants.

[0045] 1. Induction and pre-culture of mature embryo callus

[0046] The mature seeds of Nipponbare (the Paddy Rice Research Institute of Anhui Academy of Agricultural Sciences are preserved) are shelled, and the seeds with normal appearance and cleanness without mildew are selected, shaken for 90 sec with 70% alcohol, and pour off the alcohol; then use 50% sodium hypochlorite ( The concentration of available chlorine in the stock solution is greater than 4%. Add 1 drop of Tween20) solution per 100 milliliters to clean the seeds, and shake for 45 minutes (180 r / min) on a shaker. Pour off the sodium hypochlorite, wash with sterile water 5-10 times until there is no smell of sodium hypochlorite, finally add sterile water, soak overnight at 30°C. Use a scalpel to separate the embryos along the aleurone layer, put the scutellum up on the induction medium (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides PL-LbCpf1-RVR gene for recognizing specific sites in rice gene targeting and application thereof. The novel PL-LbCpf1-RVR gene is accidentally acquired during a rice gene targeting experiment; it is discovered that the PL-LbCpf1-RVR gene can be used to shear rice to recognize specific sites, with more genome sites recognized. In addition, the invention provides an expression cassette and expression vector constructed based on the PL-LbCpf1-RVR gene, as well as application of the expression cassette and expression vector in rice gene editing. A plant expression vector is constructed by using the acquired PL-LbCpf1-RVR gene, a rice targeting vector is constructed, DNA double-chain shearing of rice specific gene sites is caused after the vector is introduced into rice cells, rice gene targeting is achieved, and transgenic rice plants are acquired under high mutation efficiency.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and plant genetic engineering. Specifically, the present invention relates to a PL-LbCpf1-RVR gene for identifying specific sites in gene targeting and its application in rice gene targeting. Background technique [0002] The CRISPR / Cas gene editing system has become an important means for plant functional gene research and molecular breeding. Traditional CRISPR / Cas systems mostly use Cas9 protein as an endonuclease to cause site-specific cleavage at target sites in the plant genome, thereby introducing site-specific mutations. Recently, another Cas protein, Cpf1, was found from bacteria to also have endonuclease activity. Compared with Cas9 protein, Cpf1 has some characteristics in cutting principle and editing mode. For example: Cas9 recognizes a cytosine-rich PAM (Protospacer adjacent motif) sequence at the 3' end, while Cpf1 recognizes a thymine-rich PAM sequence at the 5' end; Cas9 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/55C12N15/82A01H4/00A01H5/00
CPCA01H4/00C12N9/22C12N15/8213
Inventor 秦瑞英杨剑波许蓉芳李浩李莉魏鹏程李娟
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI