Quantitative detection method of fusarium oxysporum f. sp. niveum in soil
A watermelon fusarium wilt, quantitative detection method technology, applied in the biological field, can solve the problems of inability to intuitively understand the watermelon fusarium wilt concentration, no watermelon fusarium wilt quantitative detection method, etc., to achieve the effect of overcoming unreliability and solving unintuitiveness
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Primer-specific detection of Fusarium wilt of watermelon.
[0039] (1) Total DNA preparation of each strain:
[0040] Fusarium oxysporum watermelon-specific FW0 and Fusarium oxysporum cucumber-specific FOC were cultured on potato dextrose agar medium, and then the total DNA was extracted with OMEGA fungal DNA extraction kit; Bacillus subtilis was cultured with beef extract peptone liquid medium BS211, and then use the OMEGA Bacterial DNA Extraction Kit to extract the total DNA.
[0041] (2) Specific primer synthesis:
[0042] Fon-1: CGATTAGCGAAGACATTCACAAGACT
[0043] Fon-2: ACGGTCAAGAAGATGCAGGGTAAAGGT
[0044] Synthesized by GenScript Biotechnology Co., Ltd.
[0045] (3) PCR amplification of specific fragments of Fusarium wilt of watermelon, Fusarium cucumber, Bacillus subtilis:
[0046] The DNA of each strain was used as a template, and Fon-1 and Fon-2 were used as upstream and downstream primers for PCR amplification.
[0047] The PCR reaction system is as foll...
Embodiment 2
[0056] Prepare standard soil samples with known concentration of Fusarium wilt of watermelon.
[0057] (1) Preparation of watermelon Fusarium wilt spore liquid:
[0058] Inoculate the mycelial mass of Fusarium wilt of watermelon into a conical flask filled with 500 mL of mung bean liquid medium, culture on a shaker at 30°C and 170 r / min for 4 days to obtain the spore liquid of Fusarium wilt of watermelon, count on a hemocytometer and set aside.
[0059] (2) Preparation of standard soil samples:
[0060] In the paddy field of Liuhe base of Jiangsu Academy of Agricultural Sciences, the plow layer soil was taken and sterilized at 121°C for 30 minutes to obtain soil samples; the spore liquid of Fusarium wilt of watermelon was diluted to a concentration of 2×10 in sequence with sterile water. 8 , 2×10 7 , 2×10 6 , 2×10 5 , 2×10 4 , 2×10 3 and 2×10 2 Individual / mL; 10mL of diluted spore liquid was added to 10g of obtained soil samples respectively and quickly air-dried to obt...
Embodiment 3
[0062] Quantitative detection of Fusarium wilt of watermelon in soil samples to be tested.
[0063] (1) Preparation of total DNA of standard soil samples and soil samples to be tested:
[0064] The soil samples to be tested were taken from the plow layer soil where 1 crop and 2 crops of watermelons were planted in the watermelon facility greenhouse of Liuhe Base, Jiangsu Academy of Agricultural Sciences. The MP soil DNA extraction kit was used to extract the total DNA of the soil samples to be tested; the MP soil DNA extraction kit was used to extract The concentration of Fusarium wilt of watermelon extracted from the box was 2×10 8 , 2×10 7 , 2×10 6 , 2×10 5 , 2×10 4 , 2×10 3 and 2×10 2 The total DNA of a series of gradient standard soil samples / g soil.
[0065] (2) PCR reaction system for quantitative detection of watermelon Fusarium wilt:
[0066] The 20 μL quantitative PCR reaction system is as follows: 2×SYBR Premix Ex Taq 10 μL, 10 μmol / L Fon-1 / Fon-2 primers 0.4 ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| PCR efficiency | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


