Unlock instant, AI-driven research and patent intelligence for your innovation.

Quantitative detection method of fusarium oxysporum f. sp. niveum in soil

A watermelon fusarium wilt, quantitative detection method technology, applied in the biological field, can solve the problems of inability to intuitively understand the watermelon fusarium wilt concentration, no watermelon fusarium wilt quantitative detection method, etc., to achieve the effect of overcoming unreliability and solving unintuitiveness

Inactive Publication Date: 2017-09-15
JIANGSU ACAD OF AGRI SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Zhang Zhenggang et al. also established a fluorescent quantitative PCR method that can quantitatively detect Fusarium wilt of watermelon. However, this method quantifies the DNA concentration of Fusarium watermelon to quantify the sample to be tested, and the unit of the result is ng DNA per gram of soil, not the number of bacteria per gram of soil. , cannot intuitively understand the concentration of watermelon wilt bacteria in the soil
In addition, there is no domestic patent for the quantitative detection method of Fusarium wilt of watermelon

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quantitative detection method of fusarium oxysporum f. sp. niveum in soil
  • Quantitative detection method of fusarium oxysporum f. sp. niveum in soil
  • Quantitative detection method of fusarium oxysporum f. sp. niveum in soil

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Primer-specific detection of Fusarium wilt of watermelon.

[0039] (1) Total DNA preparation of each strain:

[0040] Fusarium oxysporum watermelon-specific FW0 and Fusarium oxysporum cucumber-specific FOC were cultured on potato dextrose agar medium, and then the total DNA was extracted with OMEGA fungal DNA extraction kit; Bacillus subtilis was cultured with beef extract peptone liquid medium BS211, and then use the OMEGA Bacterial DNA Extraction Kit to extract the total DNA.

[0041] (2) Specific primer synthesis:

[0042] Fon-1: CGATTAGCGAAGACATTCACAAGACT

[0043] Fon-2: ACGGTCAAGAAGATGCAGGGTAAAGGT

[0044] Synthesized by GenScript Biotechnology Co., Ltd.

[0045] (3) PCR amplification of specific fragments of Fusarium wilt of watermelon, Fusarium cucumber, Bacillus subtilis:

[0046] The DNA of each strain was used as a template, and Fon-1 and Fon-2 were used as upstream and downstream primers for PCR amplification.

[0047] The PCR reaction system is as foll...

Embodiment 2

[0056] Prepare standard soil samples with known concentration of Fusarium wilt of watermelon.

[0057] (1) Preparation of watermelon Fusarium wilt spore liquid:

[0058] Inoculate the mycelial mass of Fusarium wilt of watermelon into a conical flask filled with 500 mL of mung bean liquid medium, culture on a shaker at 30°C and 170 r / min for 4 days to obtain the spore liquid of Fusarium wilt of watermelon, count on a hemocytometer and set aside.

[0059] (2) Preparation of standard soil samples:

[0060] In the paddy field of Liuhe base of Jiangsu Academy of Agricultural Sciences, the plow layer soil was taken and sterilized at 121°C for 30 minutes to obtain soil samples; the spore liquid of Fusarium wilt of watermelon was diluted to a concentration of 2×10 in sequence with sterile water. 8 , 2×10 7 , 2×10 6 , 2×10 5 , 2×10 4 , 2×10 3 and 2×10 2 Individual / mL; 10mL of diluted spore liquid was added to 10g of obtained soil samples respectively and quickly air-dried to obt...

Embodiment 3

[0062] Quantitative detection of Fusarium wilt of watermelon in soil samples to be tested.

[0063] (1) Preparation of total DNA of standard soil samples and soil samples to be tested:

[0064] The soil samples to be tested were taken from the plow layer soil where 1 crop and 2 crops of watermelons were planted in the watermelon facility greenhouse of Liuhe Base, Jiangsu Academy of Agricultural Sciences. The MP soil DNA extraction kit was used to extract the total DNA of the soil samples to be tested; the MP soil DNA extraction kit was used to extract The concentration of Fusarium wilt of watermelon extracted from the box was 2×10 8 , 2×10 7 , 2×10 6 , 2×10 5 , 2×10 4 , 2×10 3 and 2×10 2 The total DNA of a series of gradient standard soil samples / g soil.

[0065] (2) PCR reaction system for quantitative detection of watermelon Fusarium wilt:

[0066] The 20 μL quantitative PCR reaction system is as follows: 2×SYBR Premix Ex Taq 10 μL, 10 μmol / L Fon-1 / Fon-2 primers 0.4 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
PCR efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention discloses a quantitative detection method of fusarium oxysporum f. sp. niveum in soil. The quantitative detection method comprises the following steps: firstly preparing a series of gradient standard soil samples containing fusarium oxysporum f. sp. niveum with different concentrations; extracting total DNAs from the series of gradient standard soil samples and a to-be-detected soil sample; performing a fluorescence quantitative PCR reaction on the total DNAs of the series of gradient standard soil samples and the to-be-detected soil sample by using specific primers; making a standard curve according to the fusarium oxysporum f. sp. niveum concentrations of the series of gradient standard soil samples and corresponding Ct values, and calculating the fusarium oxysporum f. sp. niveum concentration of the to-be-detected soil sample. According to the quantitative detection method, the standard curve is made according to the standard soil samples with the known fusarium oxysporum f. sp. niveum concentrations, and then the fusarium oxysporum f. sp. niveum concentration of the to-be-detected soil sample is quantitatively detected; a result unit is the number of bacteria per gram of soil; operation steps are high in efficiency and convenient; the fusarium oxysporum f. sp. niveum concentration of the soil can be accurately and rapidly detected; the quantitative detection method is suitable for large-scale popularization and application.

Description

technical field [0001] The invention belongs to the field of biological technology and relates to microorganism detection, in particular to a quantitative detection method for watermelon wilt pathogen in soil. Background technique [0002] Fusarium wilt of watermelon is a disease of the vascular system caused by the infection of Fusarium oxysporum f.sp.niveum, the pathogen of watermelon wilt. Occurs to varying degrees. In recent years, due to changes in planting systems (such as high-yield continuous cropping), the disease has become a major obstacle to the development of my country's watermelon industry. Therefore, accurate and rapid detection of Fusarium wilt of watermelon is of great significance for the comprehensive control of Fusarium wilt of watermelon in an area. [0003] At present, the quantitative detection method of Fusarium wilt of watermelon usually adopts selective culture medium to isolate and culture the pathogen and count the colonies. This method is ina...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/06
CPCC12Q1/6851C12Q2545/114C12Q2563/107
Inventor 张晶马艳宋修超郭德杰王光飞王秋君
Owner JIANGSU ACAD OF AGRI SCI