Gene synthesis method

A gene synthesis and gene technology, applied in the field of gene synthesis, can solve the problems of writing genes in cumbersome experimental steps, limiting throughput and per capita production capacity, material resources and time consumption, etc., achieving the effect of clear background, increasing per capita production capacity, and ensuring accuracy

Inactive Publication Date: 2017-09-22
WUHAN GENECREATE BIOLOGICAL ENG CO LTD
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The principle of this technology is simple and easy to use, but the operation process is very complicated. The whole process needs to go through tedious experimental steps such as PCR system preparation, on-board amplification, electrophoresis detection and recovery, enzyme digestion and connection, transformation, etc. At the same time, the PCR process will The amplification of the mutation itself leads to synthesis errors; and high-level structures such as highly repetitive sequences, high GC, high AT, inverted repeats, and palindromes fail to be synthesized due to the failure of PCR to amplify normally, which has become the first choice of PCR-based gene synthesis technology A major difficulty and bottleneck
Corresponding to it is a large amount of manpower, material resources and time consumption, thus greatly limiting the synthetic throughput and per capita production capacity
With the continuous deepening of gene research, currently "reading genes" (gene sequencing) has a fully automatic high-throughput sequencer, but "writing genes" (gene synthesis) all rely on artificial synthesis, so cumbersome experimental steps, current technical means The inherent short board has become the speed-limiting step for writing genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene synthesis method
  • Gene synthesis method
  • Gene synthesis method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0033] The embodiment gene synthesis method of the present invention, described method comprises:

[0034] (1) Divide the gene sequence to be synthesized into the first continuous fragment of 55-100bp length, and design the first continuous fragment as a forward primer; use the gene sequence at a length of 15-20bp staggered from the first continuous fragment as the first continuous fragment Two continuous fragments, designing continuous reverse primers on the reverse complementary sequence of the second continuous fragment;

[0035] (2) mixing the forward primer and the reverse primer to obtain a primer mixture;

[0036] (3) boiling and annealing the primer mixture to obtain double-stranded DNA fragments containing multiple nicks;

[0037] (4) The synthetic double-stranded DNA fragment was connected to the pUC57-GFP-Amp carrier, the sequence of the carrier was as shown in Sequence Table 1, transformed into Escherichia coli cells, reverse screening of non-fluorescent bacterium...

Embodiment 1

[0048] The preparation method of pUC57-GFP-Amp vector includes:

[0049] 1. A pUC57 vector is provided, and the SapI site on the pUC57 vector is mutagenized to remove the SapI site. Then, the MCS (Multiple Cloning Site) was modified to retain only the EcoRI and HindIII sites at both ends, and a sequence was designed in front of the EcoRI site and behind the HindIII site respectively, so that a relatively long sticky DNA was obtained after one treatment with T4 DNA polymerase. Sexual end effect. A GFP ORF (open reading frame) was filled between the EcoRI and HindIII sites, and the vector was named pUC57-GFP-Amp.

[0050] The specific steps are as follows:

[0051] 1.1 Mutagenesis of the SapI site: design primers (underlined bases are mutated bases)

[0052] pUC57-SapImut-F:5'GCGTATTGGGCGC A CTTCCGCTTCCTCGCTCACTGACTC3'

[0053] pUC57-SapImut-R:5'GCGAGGAAGCGGAAG T GCGCCCAATACGCAAAC 3'

[0054] The pUC57-Amp vector was used as a template to amplify, and the amplified produc...

Embodiment 2

[0094] The preparation method of the pUC57-GFP-Amp vector is similar to that of Example 1 and will not be repeated here.

[0095] 1. Gene grouping (the underline is the annealing sequence with the vector, the wavy line is the BbsI site, and the italic part is the Golden Gate cloning reaction site)

[0096] 16128A(747bp)

[0097] caagagagaatt c ccatggcaacaggaactgagaaaaagcaccaagaaaagctttatatccctaagctaaaggttcatcagatcaagctagagctcttttatgaggccggtcatggacaggtggcctttgataacctttctttgagagaggctggtgataagccaagtgatgacatcaaggttgcttcacatcacttagaggagcaaatcgtcctgcctttaaataagcactacctcatggaaatggctgactatcactatcagattgcagcggagtccagcaacattgtgcgcgtggaaaatggtcttttgattcctttgtctcacgggaaaacgcttttagaggtgttggatcaagaggggcaaagagtagcaacagtgccggttgagattttagcagcagaggaccctcaaacaacctccttgatcacaaagtggtgtgaggtgattttgggggctgaaaactttgaccgatcaagtccagctatggtggcattaaaccaaaaactggacgacagtgtgagcaaaaatctagttcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtcctgaggcggaaagaaccagctgtggaatgtgtgtcagttagggtgtgga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene synthesis method. The method comprises the steps that 1, a to-be-synthesized gene sequence is divided into a first continuous fragment with the length being 55-100 bp, the first continuous fragment is designed to be a forward primer, a gene sequence staggered with the first continuous fragment at the portion of the length of 15-20 bp serves as a second continuous fragment, and continuous reverse primers are designed on a reverse complementary sequence of the second continuous fragment; 2, the forward primer is mixed with the reverse primers; 3, the primer mixture is boiled, annealing is conducted, T4DNA ligase is added, and the primers are connected into a double-stranded DNA gene with the two ends provided with the long sticky tail ends; 4, the synthesized double-stranded DNA gene is connected to a pUC57-GFP-Amp carrier, the sequence of the pUC57-GFP-Amp carrier is shown as a sequence table 1, escherichia coli cells are converted, a non-fluorescing bacterial colony is reversely screened, and sequencing verification is conducted. Accordingly, the method does not reply on PCR amplification, and the defects that the experimental procedure in PCR amplification is tedious, and the PCR technical error rate is high are overcome.

Description

technical field [0001] The invention relates to the field of gene synthesis, in particular to a gene synthesis method. Background technique [0002] At present, gene synthesis technology generally uses DNA polymerase to simulate DNA replication in vitro. Primers with homologous sequences can extend each other under the action of DNA polymerase to obtain target DNA fragments. Finally, the obtained DNA fragments are separated and purified and cloned into Sequencing verification in the specified vector, we call this technology PCR-based gene synthesis technology. The principle of this technology is simple and easy to use, but the operation process is very complicated. The whole process needs to go through tedious experimental steps such as PCR system preparation, on-board amplification, electrophoresis detection and recovery, enzyme digestion and connection, transformation, etc. At the same time, the PCR process will The amplification of the mutation itself leads to synthesis ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12N15/70
CPCC12N15/10C12N15/70
Inventor沈鹤霄华权高杨明波
OwnerWUHAN GENECREATE BIOLOGICAL ENG CO LTD