Gene VII type Newcastle disease vaccine
A technology of Newcastle disease virus and gene, applied in the field of vaccine preparation, can solve the problems of unsuitable virus strain, economic loss of breeding industry, inability to completely prevent the spread and spread of Newcastle disease virus, and achieve the effect of broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1 Screening and sequence analysis of wild type VII NDV strain
[0018] Two suspected NDV strains were isolated from clinically ill chickens, and allantoic fluid was collected from chicken embryos, and HA titer was determined. Design primers based on the F gene sequence of NDV published by NCBI to identify Newcastle disease strains. Upstream primer: NDV F-F: ATGGGCTCCAAACCTTCTACCAG; downstream primer: NDV F-R: AAACTGCTGCATCTTCCCAACCG.
[0019] Take 250uL of the collected allantoic fluid to extract RNA according to conventional methods and reverse transcription. Use NDV F-F / NDV F-R as primers to amplify some fragments of F gene, the size of the fragment is about 500bp. After nucleic acid electrophoresis, the positive bands were cut out, recovered, and connected to the T vector for sequencing. Take the sequence of F gene between 47nt and 420nt to draw a gene evolution tree, and analyze the genotype of the isolated virus strain. The GenBank accession numbers of the s...
Embodiment 2
[0021] Example 2 Determination of MDT and ICPI of Newcastle Disease SL and WF Strains
[0022] MDT refers to the average time for the death of chicken embryos due to the minimum lethal dose. MDT less than 60h is a highly virulent NDV strain; MDT between 60h and 90h is a moderately virulent strain; MDT greater than 90h is a weakly virulent strain . Use sterile saline to dilute the freshly harvested toxic allantoic fluid by 10 times, and take 10 ‐6 , 10 ‐7 , 10 -8 And 10 -9 Four dilutions were used to inoculate 10-day-old chicken embryos, 5 for each dilution, and 0.1 mL was injected into the allantoic cavity of each embryo. The embryos were photographed once in the morning and afternoon each day, and the death time of each embryo was recorded and observed for 7 consecutive days. (The results are shown in Table 1) The MDT calculation formula is:
[0023]
[0024] ICPI refers to the brain disease index of 1-day-old chicks. Take 15 1-day-old SPF chicks and inject 10 into each br...
Embodiment 3
[0030] Example 3: Determination of the whole genome sequence of Newcastle disease WF strain and SL strain
[0031] In order to determine whether the p protein is also mutated, 9 pairs of primers were designed according to the NDV gene sequence published by NCBI, and some nucleic acid sequences between adjacent amplified fragments overlapped with each other. The primers were synthesized by Shanghai Shenggong Biological Engineering Co., Ltd., and the sequence is shown in Table 2.
[0032] Table 2 The primer sequence for amplifying the whole genome of NDV SL strain
[0033]
[0034]
[0035] The virus RNA was extracted by conventional methods, reverse transcription, the above primers were amplified by PCR, connected to PMD 19-T vector for sequencing, and the measured sequences were compared on the NCBI website and spliced with Lasergene software to obtain the complete gene sequences of WF strain and SL strain.
[0036] The results showed that the genomes of the WF strain and the SL str...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More