Unlock instant, AI-driven research and patent intelligence for your innovation.

Applications of CvBV26-4 gene in reduction of immunity of fruit flies and preparation of immunocompromised fly model

A technology with low immunity and immunity, applied in the fields of molecular biology and genetic engineering, can solve the problems of death of transgenic fruit flies, and achieve the effect of enhanced screening and high expression

Active Publication Date: 2017-09-29
ZHEJIANG UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, more toxic genes are usually easy to cause the death of transgenic fruit flies; therefore, finding suitable toxic genes is an important part of establishing immune-compromised fruit flies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of CvBV26-4 gene in reduction of immunity of fruit flies and preparation of immunocompromised fly model
  • Applications of CvBV26-4 gene in reduction of immunity of fruit flies and preparation of immunocompromised fly model
  • Applications of CvBV26-4 gene in reduction of immunity of fruit flies and preparation of immunocompromised fly model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Construction of transgenic Drosophila

[0030] According to the sequence at both ends of the open reading frame (ORF, shown in SEQ ID NO.1) of the CvBV26-4 gene and the sequence of the multiple cloning site on the pUASttb vector, combined with the mode of action of homologous recombinase, specific primers were designed. The primer sequences are as follows:

[0031] F: 5'- TTCGTTAACAGATCTGCGGCCGC ATGATGTTTCTTCAGCAAATTACC_-3’

[0032] R: 5'- TCCTCTAGAGGTACCTCTCGAG TTAACTAGATTGTAGATAAGGATA-3';

[0033] Trizol (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from hemocytes of Plutella xylostella after parasitism, and a cDNA library was constructed using the kit SMART RACE cDNA Amplification kit (Clontech, USA). Then, use specific primers F, R to amplify the CvBV26-4 gene fragment with restriction sites from the cDNA library constructed by PCR, and use homologous recombinase (ClonExpress II One Step Cloning Kit, Novozyme, Nanjing ) to recombine the frag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses applications of a CvBV26-4 gene in the reduction of the immunity of fruit flies and the preparation of an immunocompromised fly model. The CvBV26-4 gene is a fourth gene on the 26th loop in 35 genome fragments of Cotesia plutellae polydanvirus DNA, and the base sequence of the CvBV26-4 gene is represented by SEQ ID NO. 1. The Cotesia plutellae polydanvirus CvBV26-4 gene is transferred to a fruit fly genome by using a transgenic technology to obtain a stable-inheritance homozygotic transgenic fruit fly strain; and the transgenic strain has a blood corpuscle apoptosis phenomenon after expressing the polydanvirus DNA gene with CvBV26-4, has obvious low immunity after being invaded by pathogens, and is of great significance to research the insect immunization correlated mechanism and enhance and screen human immunity enhancing medicines.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and genetic engineering, in particular to the application of CvBV26-4 gene in reducing the immunity of Drosophila and preparing the model of low immunity Drosophila. Background technique [0002] Insects are currently the most prosperous species group on the earth's land, and they are an inexhaustible treasure house of resources for human beings. In recent years, the immunity of insects has received great attention in its basic and applied research. Experiments are used to study the mechanisms and signals related to insect immunity. etc. have very important practical significance. [0003] Fruit flies belong to the order Diptera, the genus Drosophila, and the family Drosophila, with about 1,000 species. Among them, Drosophila has the characteristics of short life cycle, easy breeding, fast reproduction, few chromosomes, many mutant types, and easy observation. It is widely used as an ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/34C07K14/01C12N15/85A01K67/033
CPCA01K67/0339A01K2207/05A01K2227/706A01K2267/0387C07K14/005C12N15/8509
Inventor 陈学新王泽华黄健华时敏周悦南
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More