Primer, molecular beacon and kit of MTRR gene polymorphism rapid test and testing method thereof
A gene polymorphism and molecular beacon technology, applied in the field of primers for the rapid detection of MTRR gene polymorphism, can solve the problems of increased detection operation steps, low success rate, reagent contamination, etc., and achieve shortened detection time, simplified operation, real-time Detection effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 3
[0085] (3) Preparation of 200X cell lysate in embodiment three
[0086] Use a 1.5ml centrifuge tube, add 300ul SDS and 56.34ul Triton X-100, then add 643.66ul nuclease-free water to a total volume of 1000ul, make the final concentration of SDS reach 3%, make the final concentration of TritonX-100 reach 6% , that is, 200x cell lysate, then shake and mix well, and store at -4°C.
[0087] The gene sequence of the upstream primer 5'-3' is: ATGCTACACAGCAGGGACAG;
[0088] The gene sequence of the downstream primer 5'-3' is: CACTAATACAGTGAAGATCTGCAG.
[0089] The gene sequence of the wild-type molecular beacon 5'-3' is:
[0090] Alexa Fluor 488 labeling-CGCGCTTTG+CTCAC+A+T+ATTTCTTCTAGCGCG-BHQ1 labeling;
[0091] The gene sequence of the mutant molecular beacon 5'-3' is:
[0092] Alexa Fluor 594 labeling-CGCGCTTTG+CTCACA+C+ATTTCTTCTAGCGCG-BHQ2 labeling;
[0093] + is the modified base of locked nucleic acid.
[0094] The above raw materials, except for specific primers, molecula...
Embodiment 1
[0114] The result of embodiment one is:
[0115] Depend on figure 1 It can be seen that only the A line has exponential growth, but the G line has no exponential growth, so the test result is wild-type AA, suggesting that the expression or activity of the detected gene may be normal, and this genotype is a normal metabolic type;
[0116] Depend on figure 2 It can be seen that both A line and G line have exponential growth, indicating that the test result is mutation heterozygous GA, suggesting that the activity of the detected gene may decrease, and this genotype belongs to the moderate metabolic type;
[0117] Depend on image 3 It can be seen that only the G line has exponential growth, but the A line has no exponential growth, indicating that the test result is a homozygous mutant GG, indicating that the activity of the detected gene is significantly reduced or may be lost, and its activity decline or loss may lead to a decrease in the blood concentration of the active i...
Embodiment 2
[0119] The result of embodiment two is:
[0120] Depend on Figure 4 It can be seen that only the A line has exponential growth, but the G line has no exponential growth, so the test result is wild-type AA, suggesting that the expression or activity of the detected gene may be normal, and this genotype is a normal metabolic type;
[0121] Depend on Figure 5 It can be seen that both A line and G line have exponential growth, indicating that the test result is mutation heterozygous GA, suggesting that the activity of the detected gene may decrease, and this genotype belongs to the moderate metabolic type;
[0122] Depend on Figure 6 It can be seen that only the G line has exponential growth, but the A line has no exponential growth, indicating that the test result is a homozygous mutant GG, indicating that the activity of the detected gene is significantly reduced or may be lost, and its activity decline or loss may lead to a decrease in the blood concentration of the active...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap