Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, molecular beacon and kit of MTRR gene polymorphism rapid test and testing method thereof

A gene polymorphism and molecular beacon technology, applied in the field of primers for the rapid detection of MTRR gene polymorphism, can solve the problems of increased detection operation steps, low success rate, reagent contamination, etc., and achieve shortened detection time, simplified operation, real-time Detection effect

Inactive Publication Date: 2017-10-13
重庆京因生物科技有限责任公司
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Extracting and purifying DNA requires additional steps of drawing blood and extracting blood DNA. It takes 4 hours to complete the whole process, which not only causes pain, but also wastes a lot of time
In the prior art, capillary electrophoresis analysis is required after PCR amplification, and it takes at least 1 hour to add this operation step
In addition, the reagents currently on the market are composed of multiple components. Professional operators are required to use them, and the reagents need to be prepared according to the reagent components and instructions in the kit before they can be used. This process is likely to cause contamination of the reagents and the success of the test. The detection rate is low, and the detection operation steps are increased, the detection time is prolonged, and the whole process of obtaining the detection results takes at least 8 hours
Therefore, it is difficult to meet the rapid diagnosis of clinical diseases, which increases the risk of patients' disease treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, molecular beacon and kit of MTRR gene polymorphism rapid test and testing method thereof
  • Primer, molecular beacon and kit of MTRR gene polymorphism rapid test and testing method thereof
  • Primer, molecular beacon and kit of MTRR gene polymorphism rapid test and testing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 3

[0085] (3) Preparation of 200X cell lysate in embodiment three

[0086] Use a 1.5ml centrifuge tube, add 300ul SDS and 56.34ul Triton X-100, then add 643.66ul nuclease-free water to a total volume of 1000ul, make the final concentration of SDS reach 3%, make the final concentration of TritonX-100 reach 6% , that is, 200x cell lysate, then shake and mix well, and store at -4°C.

[0087] The gene sequence of the upstream primer 5'-3' is: ATGCTACACAGCAGGGACAG;

[0088] The gene sequence of the downstream primer 5'-3' is: CACTAATACAGTGAAGATCTGCAG.

[0089] The gene sequence of the wild-type molecular beacon 5'-3' is:

[0090] Alexa Fluor 488 labeling-CGCGCTTTG+CTCAC+A+T+ATTTCTTCTAGCGCG-BHQ1 labeling;

[0091] The gene sequence of the mutant molecular beacon 5'-3' is:

[0092] Alexa Fluor 594 labeling-CGCGCTTTG+CTCACA+C+ATTTCTTCTAGCGCG-BHQ2 labeling;

[0093] + is the modified base of locked nucleic acid.

[0094] The above raw materials, except for specific primers, molecula...

Embodiment 1

[0114] The result of embodiment one is:

[0115] Depend on figure 1 It can be seen that only the A line has exponential growth, but the G line has no exponential growth, so the test result is wild-type AA, suggesting that the expression or activity of the detected gene may be normal, and this genotype is a normal metabolic type;

[0116] Depend on figure 2 It can be seen that both A line and G line have exponential growth, indicating that the test result is mutation heterozygous GA, suggesting that the activity of the detected gene may decrease, and this genotype belongs to the moderate metabolic type;

[0117] Depend on image 3 It can be seen that only the G line has exponential growth, but the A line has no exponential growth, indicating that the test result is a homozygous mutant GG, indicating that the activity of the detected gene is significantly reduced or may be lost, and its activity decline or loss may lead to a decrease in the blood concentration of the active i...

Embodiment 2

[0119] The result of embodiment two is:

[0120] Depend on Figure 4 It can be seen that only the A line has exponential growth, but the G line has no exponential growth, so the test result is wild-type AA, suggesting that the expression or activity of the detected gene may be normal, and this genotype is a normal metabolic type;

[0121] Depend on Figure 5 It can be seen that both A line and G line have exponential growth, indicating that the test result is mutation heterozygous GA, suggesting that the activity of the detected gene may decrease, and this genotype belongs to the moderate metabolic type;

[0122] Depend on Figure 6 It can be seen that only the G line has exponential growth, but the A line has no exponential growth, indicating that the test result is a homozygous mutant GG, indicating that the activity of the detected gene is significantly reduced or may be lost, and its activity decline or loss may lead to a decrease in the blood concentration of the active...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit of MTRR gene polymorphism rapid test. The kit comprises PCR reaction liquid; the PCR reaction liquid is prepared from 0.04-0.09 U / microliter of DNA polymerase, 0.1-0.5 mM of dNTPS, 0.5-1.5 X of 5X PCR buffer solution, 1-2.5 mM of MgCl2, 0.0005-0.015%(w / v) of lauryl sodium sulfate, 0.001-0.03%(w / v) of polyethylene glycol octylphenol ether, 0.2-1.0 muM of upstream primer, 0.2-1.0 muM of downstream primer, 0.3-0.5 muM of mutant molecular beacon and 0.3-0.7 muM of wild molecular beacon, and is used for testing cell samples. The technical problem to be solved is to provide a primer, molecular beacon and kit of MTRR gene polymorphism rapid test and a testing method thereof through which sampling can be conducted in the painless environment and which are simple in operation, low in cost, rapid in test, short in time and high in success rate, and accordingly guidance is provided for individualization folic acid use, and the fetal anomaly risk is reduced.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a primer, a molecular beacon, a kit and a detection method for rapid detection of MTRR gene polymorphism. Background technique [0002] Folic acid belongs to group B vitamins and is an essential element for the synthesis of nucleic acid, a substance necessary for cell growth and tissue repair, and an indispensable nutrient for embryonic development. In recent years, a large number of studies have confirmed that once folic acid deficiency or folate metabolism enzyme deficiency occurs, it will lead to abnormal cell cycle, abnormal DNA and protein methylation reactions, DNA base synthesis, etc., which will directly or indirectly cause neonatal or Neural tube defects in fetuses as well as cardiovascular disease in adults occur. At present, studies have shown that the genes closely related to folic acid metabolism are 5,10-methylenetetrahydrofolate reductase (MTHFR) and methionine sy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6883C12Q2600/106C12Q2600/156C12Q2563/107C12Q2527/125C12Q2525/301
Inventor 罗德朋向·霄熊伟
Owner 重庆京因生物科技有限责任公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More