Watermelon flesh color character major gene locus, and InDel molecular marker and application thereof
A main effect gene and molecular marker technology, applied in the field of molecular biology and genetic breeding, can solve the problems of low selection efficiency and accuracy, low genotype and phenotype coincidence rate of watermelon meat color breeding, and achieve improved selection efficiency and accuracy efficiency, speed up the breeding process, and easily detectable effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] The specific steps for determining the main effect gene loci of watermelon flesh color traits are as follows:
[0023] (1) Genome-wide QTL mapping for flesh color of watermelon
[0024] According to the literature Shang et al., Construction of a high-density genetic map for watermelon (Citrullus lanatus L.) based on large-scale SNP discovery by specific length amplified fragment sequencing (SLAF-seq). ScientiaHorticulturae 2016,203:38-46. F 2 The high-density genetic linkage map constructed by the population, the parents, F 1 and F 2 Visual identification of flesh color in 93 single melons of the population; combined genetic linkage map and F 2 As a result of the population phenotype identification, the Rqtl-IM-binary method was used for the initial QTL mapping, and only one major QTL (FC6) for flesh color was identified in LG6, such as figure 1 As shown, its peak LOD is 23.65, explaining 90.36% of the phenotypic variation, the corresponding confidence interval (2-L...
Embodiment 2
[0030] Watermelon F 2 Population molecular marker analysis, the specific steps are as follows:
[0031] (1) Utilize the CTAB method to extract the total DNA of watermelon leaves, the specific steps are as follows:
[0032] ①Put 1g of fresh watermelon leaves into a mortar, add liquid nitrogen to grind them into powder, then transfer them to a centrifuge tube with 1mL of CTAB extraction solution, mix them well, and then place them in a constant temperature water bath at 65°C for 60 minutes, during which time Mix by inversion 2-3 times;
[0033] ②After taking it out from the water bath, centrifuge at 8000rpm for 1min;
[0034] ③Take the supernatant and put it in another centrifuge tube, add a mixture of chloroform and isoamyl alcohol equal to the volume of the supernatant, gently invert to mix well, and the volume ratio of chloroform and isoamyl alcohol is 24:1 ;
[0035] ④ Centrifuge at 10000rpm for 5min, and take the supernatant;
[0036] ⑤ Add 0.7 times the volume of isop...
Embodiment 3
[0063] f 2 The reconstruction of population genetic linkage map, the steps are as follows:
[0064] The flesh-colored phenotype was classified as a morphological marker FC_P, and JoinMap4.0 was used for map construction and linkage analysis based on FC_P and other SNP markers on LG6, and it was found that FC_P was located in the peak area of the main QTL FC6, such as figure 1 shown.
[0065] So far, we have prepared a co-dominant molecular marker InDel19_fc6 closely linked to the flesh-colored QTL (FC6), which corresponds to a 23bp indel at 21671788bp on chromosome 6, its sequence is AAATGAAACATGATATATTAAGG, and its primer sequence is, InDel19_fc6F: CTTTAATGCCTAATAACCAA; InDel19_fc6R: AAAGGAGGAAATTCAAATCA. The size of the amplified product of the primer in the female parent (pink meat) is 198bp, and the size of the amplified product in the male parent (red meat) is 175bp.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com