Check patentability & draft patents in minutes with Patsnap Eureka AI!

Watermelon flesh color character major gene locus, and InDel molecular marker and application thereof

A main effect gene and molecular marker technology, applied in the field of molecular biology and genetic breeding, can solve the problems of low selection efficiency and accuracy, low genotype and phenotype coincidence rate of watermelon meat color breeding, and achieve improved selection efficiency and accuracy efficiency, speed up the breeding process, and easily detectable effects

Active Publication Date: 2017-10-17
ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are relatively few or no genetic studies on other watermelon flesh color genes, and the coincidence rate of existing marker genotypes and phenotypes is relatively low, and the selection efficiency and accuracy of watermelon flesh color breeding using markers for assisted selection are relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Watermelon flesh color character major gene locus, and InDel molecular marker and application thereof
  • Watermelon flesh color character major gene locus, and InDel molecular marker and application thereof
  • Watermelon flesh color character major gene locus, and InDel molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] The specific steps for determining the main effect gene loci of watermelon flesh color traits are as follows:

[0023] (1) Genome-wide QTL mapping for flesh color of watermelon

[0024] According to the literature Shang et al., Construction of a high-density genetic map for watermelon (Citrullus lanatus L.) based on large-scale SNP discovery by specific length amplified fragment sequencing (SLAF-seq). ScientiaHorticulturae 2016,203:38-46. F 2 The high-density genetic linkage map constructed by the population, the parents, F 1 and F 2 Visual identification of flesh color in 93 single melons of the population; combined genetic linkage map and F 2 As a result of the population phenotype identification, the Rqtl-IM-binary method was used for the initial QTL mapping, and only one major QTL (FC6) for flesh color was identified in LG6, such as figure 1 As shown, its peak LOD is 23.65, explaining 90.36% of the phenotypic variation, the corresponding confidence interval (2-L...

Embodiment 2

[0030] Watermelon F 2 Population molecular marker analysis, the specific steps are as follows:

[0031] (1) Utilize the CTAB method to extract the total DNA of watermelon leaves, the specific steps are as follows:

[0032] ①Put 1g of fresh watermelon leaves into a mortar, add liquid nitrogen to grind them into powder, then transfer them to a centrifuge tube with 1mL of CTAB extraction solution, mix them well, and then place them in a constant temperature water bath at 65°C for 60 minutes, during which time Mix by inversion 2-3 times;

[0033] ②After taking it out from the water bath, centrifuge at 8000rpm for 1min;

[0034] ③Take the supernatant and put it in another centrifuge tube, add a mixture of chloroform and isoamyl alcohol equal to the volume of the supernatant, gently invert to mix well, and the volume ratio of chloroform and isoamyl alcohol is 24:1 ;

[0035] ④ Centrifuge at 10000rpm for 5min, and take the supernatant;

[0036] ⑤ Add 0.7 times the volume of isop...

Embodiment 3

[0063] f 2 The reconstruction of population genetic linkage map, the steps are as follows:

[0064] The flesh-colored phenotype was classified as a morphological marker FC_P, and JoinMap4.0 was used for map construction and linkage analysis based on FC_P and other SNP markers on LG6, and it was found that FC_P was located in the peak area of ​​the main QTL FC6, such as figure 1 shown.

[0065] So far, we have prepared a co-dominant molecular marker InDel19_fc6 closely linked to the flesh-colored QTL (FC6), which corresponds to a 23bp indel at 21671788bp on chromosome 6, its sequence is AAATGAAACATGATATATTAAGG, and its primer sequence is, InDel19_fc6F: CTTTAATGCCTAATAACCAA; InDel19_fc6R: AAAGGAGGAAATTCAAATCA. The size of the amplified product of the primer in the female parent (pink meat) is 198bp, and the size of the amplified product in the male parent (red meat) is 175bp.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a watermelon flesh color character major gene locus, and an InDel molecular marker and an application thereof. A genetic linkage map of an F2 group cross-bred by female parents and male parents of which the flesh colors are pink and red is combined and phenotype identification of the flesh color is carried out on the female parents, the male parents, an F1 group and the F2 group; QTL primary positioning is carried out by adopting an Rqtl-IM-binary method; the InDel primer is designed by combining resequencing of the parents; polymorphism screening is carried out on the female parents, the male parents and the F1 group by using the InDel primer and genotype identification is carried out by using the polymorphic InDel primer in the F2 group; and map construction is carried out by using JoinMap4.0. Through the technical measures, the watermelon flesh color character major gene locus FC6 is obtained and an insertion and deletion molecular marker InDel19-fc6 tightly linked with the flesh color is prepared. A novel method can be provided for identification of the watermelon flesh color, the improvement process of the watermelon flesh color is accelerated and the breeding accuracy and the selection efficiency are improved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and in particular relates to a main effect gene locus of watermelon flesh color trait and its InDel molecular marker and application. Background technique [0002] Watermelon flesh color is an important trait of watermelon genetics and breeding, and the variation of flesh color is very rich. According to the "Watermelon Gene Catalog 2012" published in the annual report of the International Cucurbit Genetics Association in 2012, there are currently 8 genes known to control the flesh color of watermelon using traditional genetic experiments: B, C, i-C, Wf, Yscr, Ycrl , yo, y. Traditional genetics uses the method of mathematical statistics, which can only study one or more genes controlling flesh color as a whole, and cannot determine the position of a single gene on the chromosome and the effect of the gene. [0003] With the development of molecular markers and seq...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 李娜马双武尚建立王吉明李楠楠
Owner ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More