Method for detecting fungaltoxin through multiple signals and kit
A mycotoxin and multi-signal technology, applied in biological testing, measuring devices, material inspection products, etc., can solve the problems of complex operation, non-target signal amplification, and targeted signal quenching, and achieve simple operation and abundant mycotoxins Recognition method and signal conversion and amplification mode, the effect of improving accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Example 1 A method for multi-signal detection of ochratoxin A (OTA)
[0063] A kind of method for multi-signal detection OTA, concrete operation step process is as follows (concrete steps are as follows figure 1 shown):
[0064] The OTA nucleic acid aptamer (5'-GATCGG GTGTGGGTGGCGTAAAGGGAGCATCGGACA -PO 4 3- -3') and 1 μM phosphorylated aptamer complementary sequence (5'- TGTCCGATGCTCCCTTTACGCCACCCACAC -PO 4 3- -3') and 0-200ppb OTA were reacted in Tris-HCl buffer (20mM Tris-HCl, pH 7.5) for 2min.
[0065] Add the above solution and 8 units of Hpy188I to the reaction buffer (20mM Tris-Ac, 10mM Mg(Ac) 2 , 50mM KAc, pH 7.9) for 60min, then the solution was heated to 65°C and kept for 20min to terminate the reaction.
[0066] Add 5 units of TdT and 1mM dNTPs (dGTP 50%, dATP 40%, dTTP 10%) to the above solution, in the reaction buffer (1M potassium cacodylate, 125mM Tris, 0.05% Triton X-100, 5mM CoCl 2 ,pH 7.2) at 37°C for 2h, then stop the reaction in a 70°C wate...
Embodiment 2
[0071] Embodiment 2 A kind of kit for multi-signal detection OTA
[0072] A kit for multi-signal detection OTA, comprising:
[0073] OTA nucleic acid aptamer, aptamer complementary sequence, enzyme digestion auxiliary signal amplification system, G4 structure preparation system, colorimetric, fluorescent and chemiluminescent detection system.
[0074] The OTA nucleic acid aptamer after phosphorylation and blocking treatment is 5′-GATCGG GTGTGGGTGGCGTAAAGGGAGCATCGGACA -PO 4 3- -3'.
[0075] The complementary sequence of the aptamer after phosphorylation and blocking treatment is 5′- TGTCCGATGCTCCCTTTACGCCACCCACAC -PO 4 3- -3'.
[0076] Enzyme-assisted signal amplification system includes Hpy188I and reaction buffer (20mM Tris-Ac, 10mM Mg(Ac) 2 , 50mM KAc, pH 7.9).
[0077] The G4 structure preparation system includes TdT, dNTPs (GTP 50%, dATP 40%, dTTP 10%), reaction buffer (1M potassium cacodylate, 125mM Tris, 0.05% Triton X-100, 5mM CoCl 2 , pH 7.2).
[0078] Col...
Embodiment 3
[0081] Example 3 A method for multi-signal detection of zearalenone (ZEN)
[0082] A method for multi-signal detection ZEN, the specific operation steps are as follows:
[0083] The ZEN aptamer (5'-GCATCACTACAGTCATTACGCATCGTGGGGATGGGAGGTTGTGTGGGGGATGGGAGGTTGT TACGCAGGAGATGTTAATCGTGTGAAGTGC -PO 4 3- -3') and 100nM phosphorylated aptamer complementary sequence (5'- GCACTTCACACGATTAACATCTCCTGCGTA -PO 4 3- -3') and 0-500ppb ZEN were reacted in Tris-HCl buffer (20mM Tris-HCl, pH 7.5) for 5min.
[0084] Add the above solution and 2 units of MseI to the reaction buffer (20mM Tris-Ac, 10mM Mg(Ac) 2 , 50mM KAc, pH 7.9) for 45min, then the solution was heated to 65°C and kept for 20min to terminate the reaction.
[0085] Add 2 units of TdT and 1mM dNTPs (dGTP 60%, dATP 40%,) to the above solution, in reaction buffer (1M potassium cacodylate, 125mM Tris, 0.05% Triton X-100, 5mM CoCl 2 ,pH 7.2), incubate at 37°C for 60min, then stop the reaction in a water bath at 70°C for 10min...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



