Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sheep triple anti-subunit vaccine and preparation method thereof

A technology of subunit vaccines and sheep triplets, applied in vaccines, multivalent vaccines, veterinary vaccines, etc., can solve the problems of difficult control of culture substrate quality, high cost, and large immunization doses

Active Publication Date: 2020-11-24
SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to make up for the deficiencies of the prior art and solve the problems in the prior art that the production process of the goat triple vaccine with four defenses is complicated, the cost is high, the quality of the culture substrate is not easy to control, which further affects the quality of the vaccine, the immune dose is large, and the immune side effects are high, the present invention Provided is a sheep triplet four-defense subunit vaccine and a preparation method thereof

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sheep triple anti-subunit vaccine and preparation method thereof
  • Sheep triple anti-subunit vaccine and preparation method thereof
  • Sheep triple anti-subunit vaccine and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0108] Example 1: Cloning of Clostridium welchii C58-1 strain β-ε and Clostridium putrefaction C55-2 strain α-toxin and construction of expression vector

[0109] 1.1 Cloning of β-ε toxin gene and construction of expression vector

[0110] According to the β and ε sequences of C58-1 strain, 6 specific primers were designed. The primer sequences are:

[0111] pεb1947s1:GCTTTTCCTAGGGATG;

[0112] pεb1947s2: AATGATATAGGTAAAACTACTAC;

[0113] pεb1947r1:CTTCGCCGCCGCTTCCGCTTTTATTCCTGGTGCC;

[0114] pεb1947r2: GGGGTCGACCTATATCATTCGCGCCGCCGCTTCTTTCGCCGC;

[0115] pεb1947r3: TACCTATATCATTCGCTTTCG;

[0116] pεb1947r4: TATTTTGAATGTAAATATATGAC. The underlined part is the AvrII and SalI restriction sites of the β and ε sequences, and the italic and bold parts are the connecting peptide sequences.

[0117] Use 1% agarose gel electrophoresis to detect the PCR amplification product, the result is as follows figure 1 shown. The results showed that there was a specific band less than 2...

Embodiment 2

[0124] Example 2 Expression and purification of β-ε and α toxin

[0125] 1.2 Expression and purification of β-ε toxin

[0126] pET1947 was mixed with BL21(DE3)pLysS competent cells and then transformed to obtain recombinant strain BL21(DE3)-pET1947; the recombinant strain BL21(DE3)-pET1947 was added to the medium of LB / Amp according to the ratio of 1:100, Shake the bacteria on a shaker at 37°C (180 r / min) for 3 h. When the OD600 reached 0.4, IPTG with a concentration of 1 mol / L was added, and an empty vector control group was set at the same time, and induced on a shaker at 37 °C for 5 h at a speed of 180 r / min. Afterwards, the induced bacterial liquid was centrifuged at 4000 r / min for 20 min, resuspended in PBS, and ultrasonically broken to a clear state. Centrifuge at 12000 r / min for 10 min at 4°C. Each 1 mL of the bacterial solution induced by ultrasonic disruption was centrifuged at 10,000 r / min for 10 min, and the precipitate and supernatant were collected for SDS-PAGE...

Embodiment 3

[0133] Example 3 Study on the immune protection of β-ε and α-toxin proteins on animals (according to the inspection standard of Sanbu sheep "triple and four-proof vaccine" of the Veterinary Pharmacopoeia of the People's Republic of China in 2010)

[0134] 3.1 Mouse lethal activity test and results

[0135] Select gelatin buffer to dilute Clostridium putrefaction α toxin recombinant protein and Clostridium perfringens β-ε fusion protein, select three titers of 50, 100, and 150ug, and inject 2 mice intraperitoneally for each titer, Observe for 3 to 5 days. The dilution method and results are shown in Table 1 below. The test results showed that the α-toxin recombinant protein of Clostridium putrefaciens and the β-ε fusion protein of Clostridium perfringens were toxic to mice, and the MLD of mice injected intraperitoneally should be between 50-100ug.

[0136] Table 1 Toxicity detection of β-ε and α toxin proteins

[0137]

[0138] 3.2 Detoxification test

[0139] 3.2.1 Deto...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses triple and four-prevention subunit vaccine for sheep and a preparation method thereof and belongs to the field of prevention and control of animal epidemic diseases. The triple and four-prevention subunit vaccine is prepared from clostridium perfringens beta-epsilon fusion protein, clostridium septicum alpha toxin recombinant protein and an adjuvant. After beta-epsilon (beta and epsilon fusion proteins) of a clostridium perfringens C58-1 strain and alpha toxin protein of a clostridium septicum C55-2 strain, which are cloned and expressed, are purified and then are mixed with the adjuvant to prepare vaccine for immunizing white mice and domestic rabbits; the triple and four-prevention subunit vaccine for the sheep is checked to be qualified by utilizing inspection standards related to the triple and four-prevention subunit vaccine for the sheep in the third volume of 2015 version of China Veterinary Pharmacopoeia; an attacking toxin protection test result shows that animals immunized with the proteins have 100 percent protection efficiency on type B, type C and type D of clostridium perfringen and clostridium septicum. Therefore, the triple and four-prevention subunit vaccine can be used for replacing traditional triple and four-prevention vaccine.

Description

technical field [0001] The invention relates to the field of prevention and control of animal epidemics, in particular to a sheep triplet four-defense subunit vaccine and a preparation method thereof. Background technique [0002] Clostridium perfringens (C. perfringens) was first isolated by British Welchii and Nuttad from a corrupted human cadaver blood vessel that produced air bubbles. Therefore, it was once named Clostridium welchii (Cl. welchii) . Clostridium perfringens is an opportunistic pathogen that can cause necrotic enteritis, enterotoxemia and traumatic gas gangrene in a variety of animals. In terms of livestock, it can cause enterotoxemia in sheep, lamb dysentery, sudden attack on cattle and sheep; flatulence and sudden death in medium and large pigs and sows, necrotic enteritis in piglets; clostridial enteritis in horses, deer, and rabbits. In terms of poultry, it can cause gangrenous dermatitis and necrotic enteritis in chickens, ducks, pigeons, etc., causi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/08A61K39/116A61P31/04C07K19/00C12N15/62C12N15/70
CPCA61K39/08A61K2039/552A61K2039/70C07K14/33C07K2319/00C12N15/62
Inventor 张松林林初文刘磊马永彪程立坤沈志强任艳玲公鑫婧陈士运孙翠平
Owner SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com