A bifunctional anti-tissue factor humanized antibody and its preparation method

A humanized antibody and tissue factor technology, applied in biochemical equipment and methods, chemical equipment and methods, botany equipment and methods, etc., can solve the problems of clinical application of humanized antibodies and reduce parental mouse monoclonal antibodies Immunogenicity, antibody affinity and specificity reduction and other issues, achieve the effect of inhibiting coagulation and tumor cell growth, strong anticoagulant and antitumor activity, and good antigen affinity

Active Publication Date: 2020-08-11
NANOLATTIX BIOTECH CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Improving the level of antibody humanization is the key to significantly reducing the immunogenicity of parental murine monoclonal antibodies. However, increasing the level of humanization can easily lead to a decrease in antibody affinity and specificity
How to balance the level of antibody humanization and the maintenance of affinity and specificity is the technical bottleneck of antibody humanization transformation, and it is also the main problem that plagues the clinical application of humanized antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A bifunctional anti-tissue factor humanized antibody and its preparation method
  • A bifunctional anti-tissue factor humanized antibody and its preparation method
  • A bifunctional anti-tissue factor humanized antibody and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Sequence Analysis and Humanization of TF Murine Antibody

[0028] (1) Sequence analysis of variable region of TF murine antibody

[0029] Using the vector phoA-VH-Linker-VL-His prepared from TF single-chain antibody (CN 103342752 A) as a template, the VH and VL gene sequences were obtained by PCR amplification. Then it was cloned into pUC57 vector to construct pUC57-VH and pUC57-VL vectors. PCR reaction system: 2 µl of 10 µM primers, 30 ng template, Prime STAR R Take 25µl of Max Premix, H 2 O20 µl, the total reaction system is 50 µl. PCR reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, 30 cycles; extension at 72°C for 10 min; 1% agarose electrophoresis gel to recover VH and VL purposes fragment.

[0030] The primers for cloning VH and VL are as follows:

[0031] VH-F: 5' TCTAGAAAGCTT GCCGCCACCATGGAGATCCAG 3'

[0032] VH-R: 5' GGATCCGAATTC TTATGAGGAGACTGT...

Embodiment 2

[0079] Example 2: Construction of pinsulator4X-CAG-TFIgG-dhfr expression vector

[0080] After the hHC gene sequence was synthesized, Sal I and Asc I double-digested the hHC gene fragment and the pinsulator4X-MSA vector respectively, electrophoresed on a 1% agarose gel, and recovered the insert1 fragment (1425 bp) and the vector1 fragment (11938 bp). The ligation product was formed overnight at 4°C. After the hLC gene sequence was synthesized, N ot I and B The hLC gene and the pCAGGS-IRES-AscI vector were double-digested with ci I, and the insert2 fragment (720 bp) and vector2 fragment (6838 bp) were recovered by electrophoresis gel, and the two were ligated overnight at 4°C to form a ligation product. Transfer the ligation product to a competent state E In .coli DH5α, single colonies were screened with ampicillin. Single colonies were cultured overnight at 37°C, plasmids were extracted from the cells, and identified by enzyme digestion.

[0081] S al I and A sc I doubl...

Embodiment 3

[0086] Embodiment 3: Expression and purification of TF humanized antibody

[0087] 1. Expression of TF humanized antibody

[0088] CHO-dhfr - Cells in 6×10 5 The density was inoculated into 6-well plates for overnight culture. Preparation of transfection complex: add 25 ul Opti-MEM and 4 ul Lipofectamine3000 to tube A, shake at room temperature for 1-2 s, add 25 ul Opti-MEM and 2 ug plasmid to tube B. Mix the above two tubes, let stand for 5 min, and then add to the 6-well culture plate. After 24 hours, cells were trypsinized into culture dishes, and MTX with a final concentration of 50 um was added for pressurized selection of cells. After 15-20 days, single cell clusters were picked and cultured in 6-well plates. When the confluence of the cells reached 90%, they were transferred to T25 culture flasks for growth. Cell density reaches 5 x 10 per ml 5 Transfer the amount of cells into Erlenmeyer flask at 37°C, 5% CO 2 , 130 rpm shaking culture, after 10-15 days of cultu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of antibody engineering, and provides a difunctional tissue factor (TF) humanized antibody and a preparation method thereof. The antibody is high in humanization degree and high in affinity and specificity with a TF; the difunctional TF humanized antibody has the activity of inhibiting blood coagulation and inhibiting proliferative activity of a tumor cell. The genes of the difunctional TF humanized antibody contain a heavy-chain gene HC consisting of a 1347bp nucleotide and a light-chain gene LC consisting of a 642bp nucleotide; the sequence of the heavy-chain gene HC is SEQ ID NO: 1; the sequence of the light-chain gene LC is SEQ ID NO: 2. The TF humanized antibody prepared by the preparation method has the humanization degree which is up to 98 percent or above, meanwhile, keeps favorable antigen affinity, and has the functions of inhibiting the blood coagulation and the growth of the tumor cell after being specifically bound with the TF.

Description

technical field [0001] The invention belongs to the technical field of antibody engineering, and in particular relates to a bifunctional anti-tissue factor humanized antibody and a preparation method thereof. Background technique [0002] Tissue factor (TF) is the initiating protein of coagulation reaction, which forms a complex by binding coagulation factor VII to initiate the body's exogenous coagulation pathway and trigger physiological coagulation. Clinical studies have shown that TF is closely related to the entire pathological process and clinical complications of atherosclerosis (AS), determines the procoagulant activity of atherosclerotic plaques, and can promote the formation of atherosclerotic thrombus. and trigger myocardial infarction. TF also has the function of a signal transduction receptor, and can participate in tumor angiogenesis by mediating a variety of signal transduction, and promote tumor invasion and metastasis. Research results have confirmed that ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K16/28C12N15/13C12N15/85
CPCC07K16/2896C07K2317/24C07K2317/73C07K2317/92C12N15/85
Inventor赵邑赵峰梅张全爱潘薇薇赵亚蕊王伟霞梁雅丽曹鹏程
OwnerNANOLATTIX BIOTECH CO LTD