Check patentability & draft patents in minutes with Patsnap Eureka AI!

A method for expressing nitrogenase gene in eukaryotic cells

A technology of eukaryotic cells and nitrogenase, applied in the field of genetic engineering, can solve the problems of less functions, narrow reaction substrate range, and low substrate reduction activity

Active Publication Date: 2021-03-30
杭州禾骑士未来生物科技有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Yilin Hu et al. showed in 2009 that NifEN has acetylene reduction activity, but it cannot reduce N2 to NH 3 + , which shows that NifEN has a catalytic effect similar to that of molybdenum iron protein, but it is only a "skeleton" of molybdenum iron protein, which is simpler in structure and has fewer functions, so its reaction substrate range is narrower , the reduction activity of the substrate is also lower
[0009] Despite extensive research on biological nitrogen fixation, there are currently no reports of successful expression of molybdenum iron in plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for expressing nitrogenase gene in eukaryotic cells
  • A method for expressing nitrogenase gene in eukaryotic cells
  • A method for expressing nitrogenase gene in eukaryotic cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] molybdenum ferroprotein structural gene NifH / NifE / NifB / NifN clone

[0056] Heliobacteriumchlorum genomic DNA was extracted according to the method of Ausubel et al. (1995).

[0057] (Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1995) Preparation of genomic DNA from bacteria. In: Current protocols in molecular biology. Wiley, New York)

[0058] Search for homologous sequence fragments of NifH / NifE / NifB / NifN in Heliobacteriumchlorum on the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ) of the NCBI website, and use Primer5 software to design primers. The primer sequences are listed in Table 1. The NifH / NifE / NifB / NifN gene sequence of 857 / 1388 / 831 / 1306bp was cloned, and the sequencing results showed that it was 100% homologous to the sequence published on the NCBI website.

[0059] PCR reaction system: 50ul

[0060] 10 pmol upstream primer,

[0061] 10 pmol downstream primer,

[0062] 2 ul template DNA,

...

Embodiment 2

[0075] Construction of NifH / NifE / NifB / NifN virus transformation vector and transfection

[0076] NifH / NifE / NifB / NifN The genes were connected into the vector Potato X pot virus (PVX) expression vector PVX-HisG-MF1 through ClaI / SalI, EagI / SalI, EagI / SalI, and ClaI / SalI restriction sites, respectively. The PVX-HisG-MF1-NifH / NifE / NifB / NifN vector has been verified by sequencing, and the gene has been successfully cloned into the expression vector. PVX-HisG-MF1-NifH / NifE / NifB / NifN was used in the transfection experiment of tobacco Nicotianabenthamiana after the in vitro transcription kit. After transfection, the tobacco was cultivated for 2-3 weeks under the conditions of 20-26 degrees, 12 hours of light and 12 hours of darkness, and the tobacco leaves with virus-infected spot symptoms were screened for protein SDS-PAGE and Western hybridization detection.

Embodiment 3

[0078] Transgenic tobacco SDS-PAGE detection and western blot analysis

[0079] The total protein of transgenic and non-transgenic tobacco leaves was extracted with a plant protein extraction kit. The obtained total protein of transgenic and non-transgenic tobacco leaves was detected by SDS-PAGE electrophoresis. Anti-his antibody (Invitrogen) antibody and horseradish peroxidase-conjugated secondary antibody (Invitrogen) were used for WESTERN hybridization detection. The results showed that NifH / NifE / NifB / NifN proteins were all successfully expressed in tobacco.

[0080] Other sequences involved in the present invention are as follows:

[0081] NifH sequence (SEQ ID No.9):

[0082]atgcgtcagatagccatttacggaaaaggtggtatcggtaaatctacgaccacccaaaacaccgtctccgccctcgccgagatgggtaaaaaaatcatgatcgtcggttgtgaccccaaagccgactctactcgtttgattcttcactccaaagcccaagcgacggttatggacctggcccgtgaaaaaggtactgtggaagacctcgaactggaagacgttctcctcaccggtttcgccgacatccgctgtgccgagtccggcggtcccgaacctggtgtaggctgtgccggccgcgg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided is a method for expressing a nitrogenase gene in an eukaryotic cell, comprising the following steps: 1) amplifying a nitrogenase gene fragment; 2) connecting the nitrogenase gene fragment to a virus transformation vector to construct a recombinant vector; 3) transfecting the eukaryotic cell by the recombinant vector constructed in step 2); and 4) screening a plant cell for expressing the nitrogenase gene. According to the present invention, the expression of the nitrogenase gene in a plant is implemented, thereby laying a foundation for autonomous nitrogen fixation of the plant.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for expressing nitrogenase gene in eukaryotic cells. Background technique [0002] The contradiction between the use of nitrogen fertilizer and my country's food, energy, environment and other major sustainable development issues is becoming increasingly acute. Biological nitrogen fixation is the main source of nitrogen needed by plants in the world, accounting for about 75%. The use of biological nitrogen fixation can reduce the use of nitrogen fertilizer. One of the important measures to solve this contradiction. However, no eukaryotic organism capable of nitrogen fixation has been found so far, and the known organisms capable of nitrogen fixation are limited to prokaryotic microorganisms such as bacteria and actinomycetes. Biological nitrogen fixation refers to the biological process in which nitrogen-fixing microorganisms use their own nitroge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/83
CPCC12N9/0095C12N15/8203C12Y118/06001
Inventor 程奇孙文丽
Owner 杭州禾骑士未来生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More