Mineralized foot-and-mouth disease virus like particle, preparation method and application thereof
A foot-and-mouth disease virus, virus-like technology, applied to foot-and-mouth disease virus-like particles and its preparation, mineralized foot-and-mouth disease virus-like particles in the field of prevention and treatment of foot-and-mouth disease, mineralized foot-and-mouth disease virus-like particles and its preparation, can solve the need for cold chain, establishment and Problems such as high operating cost and poor stability of the vaccine can achieve the effect of improving the assembly effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Construction of the foot-and-mouth disease VP1 gene recombinant plasmid of embodiment 1 chimeric mineralization peptide
[0062] 1. Construction of recombinant plasmids pSMK / VPO-VP1 and pSMA / VP3
[0063] (1) Construction of small ubiquitin-like modified protein fusion expression vectors pSMA and pSMK:
[0064] a. Using Saccharomyces cerevisiae genomic DNA as a template, using smt3F and smt3R as primers to amplify the smt3 gene, the primer sequences are as follows:
[0065] smt3F: 5'GCCATGGGTCATCACCATCATCATCATCACGGGTCGGACTCAGAAGTCAATCAA3',
[0066] smt3R: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG 3',
[0067] b. After double digestion with NcoI and BamHI, insert the smt3 gene into the pET-28a vector treated with the same endonuclease, the resulting vector is pSMK, and replace the kanamycin resistance gene of pSMK with the ampicillin resistance gene , to obtain vector pSMA;
[0068] (2) Construction of recombinant expression vector of foot-and-mouth disease stru...
Embodiment 2
[0109] The immunogenicity analysis of foot-and-mouth disease virus-like particles after embodiment 2 mineralization
[0110] W6 139 / VP3 containing mineralized peptide and VP01 / VP3 foot-and-mouth disease virus-like particles without mineralized peptide are mineralized and mixed with ISA206 adjuvant emulsified vaccine according to the method in Example 1, and the guinea pigs of immunization 200g determine the effect of mineralization process on the virus The influence of the immunogenicity of the vaccine-like particles, while using unmineralized W6 139 / VP3 and VP01 / VP3 virus-like particles as controls, the immunizing dose of each vaccine is 0.5ml, the total protein content is 50μg, and the content of virus-like particles About 3 μg, blood was collected on days 0, 7, 14, 21, 28, and 35 of immunization, and the content of specific antibodies was measured by LPB-ELISA. The results showed that the mineralized shell had a slow-release effect, and the antibodies of mineralized VLPs at ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com