Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mineralized foot-and-mouth disease virus like particle, preparation method and application thereof

A foot-and-mouth disease virus, virus-like technology, applied to foot-and-mouth disease virus-like particles and its preparation, mineralized foot-and-mouth disease virus-like particles in the field of prevention and treatment of foot-and-mouth disease, mineralized foot-and-mouth disease virus-like particles and its preparation, can solve the need for cold chain, establishment and Problems such as high operating cost and poor stability of the vaccine can achieve the effect of improving the assembly effect

Active Publication Date: 2017-12-15
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI +1
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The currently used FMD vaccine is an inactivated vaccine produced in a large bioreactor, which has the following disadvantages: (1) high cost of establishment and operation; (2) poor global production capacity; (3) affected by the surrounding environment, the vaccine Poor stability, high storage and transportation costs, need cold chain; (4) It is difficult to distinguish infected animals from immune animals; (5) Live poison is used in production, and there is a risk of loose poison
Furthermore, the current vaccines require cold chain transportation and storage, and the antigens are easily degraded under such harsh conditions, which greatly reduces the vaccine effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mineralized foot-and-mouth disease virus like particle, preparation method and application thereof
  • Mineralized foot-and-mouth disease virus like particle, preparation method and application thereof
  • Mineralized foot-and-mouth disease virus like particle, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Construction of the foot-and-mouth disease VP1 gene recombinant plasmid of embodiment 1 chimeric mineralization peptide

[0062] 1. Construction of recombinant plasmids pSMK / VPO-VP1 and pSMA / VP3

[0063] (1) Construction of small ubiquitin-like modified protein fusion expression vectors pSMA and pSMK:

[0064] a. Using Saccharomyces cerevisiae genomic DNA as a template, using smt3F and smt3R as primers to amplify the smt3 gene, the primer sequences are as follows:

[0065] smt3F: 5'GCCATGGGTCATCACCATCATCATCATCACGGGTCGGACTCAGAAGTCAATCAA3',

[0066] smt3R: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG 3',

[0067] b. After double digestion with NcoI and BamHI, insert the smt3 gene into the pET-28a vector treated with the same endonuclease, the resulting vector is pSMK, and replace the kanamycin resistance gene of pSMK with the ampicillin resistance gene , to obtain vector pSMA;

[0068] (2) Construction of recombinant expression vector of foot-and-mouth disease stru...

Embodiment 2

[0109] The immunogenicity analysis of foot-and-mouth disease virus-like particles after embodiment 2 mineralization

[0110] W6 139 / VP3 containing mineralized peptide and VP01 / VP3 foot-and-mouth disease virus-like particles without mineralized peptide are mineralized and mixed with ISA206 adjuvant emulsified vaccine according to the method in Example 1, and the guinea pigs of immunization 200g determine the effect of mineralization process on the virus The influence of the immunogenicity of the vaccine-like particles, while using unmineralized W6 139 / VP3 and VP01 / VP3 virus-like particles as controls, the immunizing dose of each vaccine is 0.5ml, the total protein content is 50μg, and the content of virus-like particles About 3 μg, blood was collected on days 0, 7, 14, 21, 28, and 35 of immunization, and the content of specific antibodies was measured by LPB-ELISA. The results showed that the mineralized shell had a slow-release effect, and the antibodies of mineralized VLPs at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mineralized foot-and-mouth disease virus like particle, a preparation method and application thereof. The invention utilizes foot-and-mouth disease VLPs (virus like particles) escherichia coli expression assembly technology platform, by means of genetic engineering, three mineralized peptides for effective enrichment of calcium ions are respectively inserted into the loop ring of foot-and-mouth disease virus structural protein VP1, the result shows that the mineralized peptide embedded VP1, the structural protein VP0 of foot-and-mouth disease virus and VP3 can be successfully expressed in escherichia coli and assembled into complete VLPs, and the assembling efficiency is not affected, then a mineralizer is employed to realize mineralization of virus like particles successfully, and at the same time the assembling effect of foot-and-mouth disease VLPs is improved. The invention promotes the transformation pace of protein vaccines from cold chain vaccines to normal temperature vaccines, and provides a new technical means for application of normal temperature vaccines.

Description

technical field [0001] The invention relates to a foot-and-mouth disease virus-like particle and a preparation method thereof, in particular to a mineralized foot-and-mouth disease virus-like particle and a preparation method thereof, and also relates to the use of the mineralized foot-and-mouth disease virus-like particle in preventing and treating foot-and-mouth disease. The invention belongs to veterinary Field of research technology with medicine. Background technique [0002] Foot-and-mouth disease (FMD) is a severe infectious disease of cloven-hoofed animals, which has brought serious economic losses to countries all over the world. FMD broke out in the UK in 2001, slaughtering 6 million animals and causing a direct economic loss of more than 800 million pounds. Therefore, countries have strengthened their policies on vaccine requirements and live animal immunization. Developed countries such as Europe and the United States have reached the state of being free of foot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/04C07K19/00C12N15/70A61K39/135A61P31/14
CPCA61K39/12A61K2039/5258A61K2039/552C07K7/08C07K14/005C07K2319/00C12N15/70C12N2770/32123C12N2770/32134A61P31/14
Inventor 郭慧琛孙世琪杜平滕志东唐睿康赵瑞波茹嘉喜魏衍全张韵郜原马军武刘湘涛殷宏
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com