Corn salt-resistant main-effect QTL (Quantitative Trait Loci) as well as related genes, molecular markers and application thereof

A molecular marker, corn technology, applied in the field of genetic engineering to achieve the effect of accelerating the breeding process

Active Publication Date: 2018-01-12
CHINA AGRI UNIV
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies in maize have shown that when grown under salt stress conditions, Na + Concentration and K + / Na + There are significant differences in the ratios (Zhao et al., 2010; Chen et al., 2016), but so far no associated QTL genes have been fine-mapped / cloned, thus cloning regulation of maize Na + 、K + Concentration and K + / Na + Ratio QTL genes are an important task in the current research on the mechanism of salt resistance in maize

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corn salt-resistant main-effect QTL (Quantitative Trait Loci) as well as related genes, molecular markers and application thereof
  • Corn salt-resistant main-effect QTL (Quantitative Trait Loci) as well as related genes, molecular markers and application thereof
  • Corn salt-resistant main-effect QTL (Quantitative Trait Loci) as well as related genes, molecular markers and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Cloning and Functional Analysis of Maize Salt Tolerance QTL Genes

[0045] The salt resistance of the two parental inbred lines of Zhengdan 958, Zheng 58 and Chang 7-2, were significantly different, such as figure 1 shown. Using the Zheng 58 / Chang 7-2 RIL population as material, the present invention locates a major salt-resistance QTL region on chromosome 3 through QTL analysis based on a mixed linear model, such as figure 2 As shown in A, at the position of 55,028-55030kb on chromosome 3, the position is determined according to the maize B73 reference genome V2. On this basis, the transcriptomes of Zheng 58 and Chang 7-2 were compared between the control and salt stress by transcriptome sequencing, and a candidate gene was identified in this QTL candidate region, named ZmNC1, whose expression level was significantly lower in Chang 7-2 Yu Zheng 58, such as figure 2 As shown in B, the results showed that the expression level of this candidate gene in Chan...

Embodiment 2

[0052] Example 2 Obtaining a Large Inserted Fragment (ZmNC1-InDel) in the Exon of the Maize Salt Tolerance QTL Gene ZmNC1

[0053] The genomic DNA of Zheng 58 and Chang 7-2 was sequenced using the Illumina sequencing platform (sequencing was completed in Beijing Nuohezhiyuan Technology Co., Ltd.), and by comparing the whole genome sequencing data of Zheng 58 and Chang 7-2, it was found that In the salt-sensitive inbred line Chang 7-2, the second exon of the ZmNC1 gene has a large insertion, named ZmNC1-InDel, such as Figure 7 As shown in A. According to the whole genome sequencing data, the inventor designed two pairs of primers ZmNC1-F1 / ZmNC1-InDel-R1 and ZmNC1-InDel-F1 / ZmNC1-R1 (the specific positions of the primers on the gene are as follows: Figure 7 shown in A). The primer sequences are:

[0054] ZmNC1-F1: TACCTGCACACATCGATCGA;

[0055] ZmNC1-InDel-R1: CAACAGGAAATGGGCTGGAC;

[0056]ZmNC1-InDel-F1: CCAGAACACACCAGGAACCA;

[0057] ZmNC1-R1: TCAGGTTGATCGAGCGAGTT.

[...

Embodiment 3

[0059] Example 3 ZmNC1-InDel insertion or deletion in maize salt resistance gene ZmNC1 as a molecular marker

[0060] Because the ZmNC1-InDel insertion only exists in the salt-sensitive maize inbred line Chang 7-2, it causes a frameshift in the reading frame of the salt-resistant gene ZmNC1 and premature termination of translation, so the ZmNC1-InDel insertion can be used to determine whether an individual is salt-tolerant molecular markers.

[0061] Using primers ZmNC1-F1 (forward) and ZmNC1-R1 (reverse) designed based on the flanking sequence of ZmNC1-InDel insertion, and primer ZmNC1-InDel-R1 (reverse) designed based on the ZmNC1-InDel insertion sequence, to the above Three primers constitute primer pair I (ZmNC1-F1 / ZmNC1-R1) and primer pair II (ZmNC1-F1 / ZmNC1-InDel-R1). Using primer pair Ⅰ and Ⅱ as primers, the genome DNA of the salt-tolerant maize inbred line Zheng 58 and the salt-sensitive maize inbred line Chang 7-2 were respectively used as templates for PCR amplifica...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a corn salt-resistant main-effect QTL (Quantitative Trait Loci) as well as related genes, molecular markers and an application thereof. The coded nucleotide sequences of the corn salt-resistant QTL genes are selected from: (a) a sequence shown as SEQ ID No.1; and (b) a nucleotide sequence which is formed by substituting, deleting and / or adding one or more nucleotides on thebasis of the sequence shown in SEQ ID No.1 and expresses proteins with the same function. In the salt-resistant QTL genes, an insertion / deletion marker which is positioned in exon of the genes and has differences between resistant and sensitive materials is identified. The marker is interlinked with the corn salt resistance and can serve as a corn salt-resistant molecular marker. The invention provides a primer and a method for detecting the salt-resistant molecular marker. Due to corn salt-resistant quantity inheritance of characters, the phenotypic analysis is time-consuming and labor-consuming, and the QTL genes, the molecular marker and the primer can be applied to salt-resistant breeding of corn.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a maize salt-resistant main effect QTL and related genes, molecular markers and applications thereof. Background technique [0002] Salinity-alkali stress is an abiotic stress that is widely distributed in nature and has a great impact on agricultural production. Its loss to agricultural production is second only to drought. In recent years, the acceleration of global salinization has further aggravated the threat of salinity to agricultural production. According to the incomplete statistics of UNESCO and FAO, the area of ​​saline-alkali land in the world is 9.5×10 9 hm 2 , about 10% of which is cultivated land. Our country has 10.0×10 7 hm 2 Saline-alkali land, of which about 20% is arable land. (Zhang JF, 2004). The saline-alkali hazard of cultivated land in northern my country is more serious than that in the south, and under the joint action of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12Q1/6895C12N15/11
Inventor蒋才富张鸣
OwnerCHINA AGRI UNIV