Nucleic acid, kit and method for simultaneous detection of yellow phytoplasma, canker pathogenic bacteria and leaf spot pathogenic bacteria

A technology for pathogenic bacteria and yellowing disease, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as compound infection, farmer loss, invasion, etc. Good effect and easy operation

Active Publication Date: 2018-01-16
QINGDAO AGRI UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, the incidence of willow canker, leaf spot and yellowing disease has been increasing, and there are more and more cases of combined infection of the three, causing heavy losses to farmers
At present, there is still a lack of high-efficiency fungicides and disease-resistant varieties for willow yellowing, canker and leaf spot. Once these diseases are found, the diseased trees need to be removed in time to prevent the spread of the disease. In addition, the epidemic-free areas must be strengthened. Therefore, it is particularly important to establish early and rapid quantitative detection methods for willow yellowing phytoplasma, canker pathogens and leaf spot pathogens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid, kit and method for simultaneous detection of yellow phytoplasma, canker pathogenic bacteria and leaf spot pathogenic bacteria
  • Nucleic acid, kit and method for simultaneous detection of yellow phytoplasma, canker pathogenic bacteria and leaf spot pathogenic bacteria
  • Nucleic acid, kit and method for simultaneous detection of yellow phytoplasma, canker pathogenic bacteria and leaf spot pathogenic bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The design of embodiment 1 primer, probe

[0051] Fluorescent quantitative PCR detection is based on ordinary PCR detection, further through a specific fluorescent probe, the probe is an oligonucleotide, and the two ends are respectively labeled with a reporter fluorescent group and a quencher fluorescent group. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; during PCR amplification, the 5'-3' exonuclease activity of Taq enzyme degrades the probe, so that the reporter fluorescent group and the quencher group The fluorescent group is separated, so that the fluorescence monitoring system can receive the fluorescent signal, that is, every time a DNA strand is amplified, a fluorescent molecule is formed, and the accumulation of the fluorescent signal is completely synchronized with the formation of the PCR product. Therefore, the premise of fluorescent quantitative PCR detection is to carry out PCR amplifica...

Embodiment 2

[0072] Example 2 Common PCR detection of three pathogens of yellowing phytoplasma, canker pathogen and leaf spot pathogen

[0073] According to the conserved sequence in the GenBank sequence number FJ1791661 of the yellowing phytoplasma screened in Example 1, primers and probes were designed in this conserved sequence. Finally, it was determined that the size of the fragment amplified by the designed primers for phytoplasma japonica was 200bp, and the amplified sequence was the sequence shown in SEQ ID No.10.

[0074] SEQ ID No. 10: GGCGTAAAGGGTGCGTAGGCGGTTAAATAAGTTTATGGTCTAAGTGCAATGCTTAACATTGTGATGCTATAAAAACTGTTTAGCTAGAGTAAGATAGAGGCAAGTGGAATTCCATGTGTAGTGGTAAAATGCGTAAATATATGGAGGAACACCAGTAGCGAAGGCGGCTTGCTGGGTCTTTACTGACGCTGAGGCACGAA.

[0075] The canker pathogen uses the conserved sequence screened by sequence number AY342165 in GenBank. The primers and probes designed in this conserved sequence have a fragment size of 166 bp and the amplified sequence is shown in SEQ ID No.11. ...

Embodiment 3

[0084] Example 3 Three kinds of pathogen fluorescence quantitative PCR detection kits

[0085] The real-time quantitative PCR detection kit for the simultaneous detection of the three pathogens of yellowing phytoplasma, canker pathogen and leaf spot pathogen includes the following components:

[0086] Premix EX Taq™×2;

[0087] The upstream primer sequence of phytoplasma chlorosis is shown in SEQ ID No.1, the downstream primer sequence is shown in SEQ ID No.2, the probe sequence is shown in SEQ ID No.3, and the 5' of the probe SEQ ID No.3 Mark TEXRED, 3' mark BHQ2;

[0088] The upstream primer sequence of the canker pathogen is shown in SEQ ID No.4, SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6. Wherein, the probe SEQ ID No. 6’s 5’-labeled FAM, 3’-labeled TAMRA;

[0089] The upstream primer sequence of the leaf spot pathogen is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID No.8, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a nucleic acid, kit and method for simultaneous detection of three pathogens, namely yellow phytoplasma, canker pathogenic bacteria and leaf spot pathogenic bacteria. The nucleic acid for simultaneous detection of the three pathogens by multiplex PCR comprises upstream and downstream primers of the three pathogens, namely yellow phytoplasma, canker pathogenic bacteria andleaf spot pathogenic bacteria. The nucleic acid for simultaneous detection of the three pathogens by fluorescent quantitative PCR further comprises probes corresponding to the pathogens respectively.The efficient and sensitive method for simultaneous detection of the three pathogens, namely yellow phytoplasma, canker pathogenic bacteria and leaf spot pathogenic bacteria is also established. The method can effectively improve detection sensitivity and avoid the occurrence of false negative results, and provides a technical method for effectively preventing the yellow disease, canker and the leaf spot disease.

Description

technical field [0001] The invention belongs to biological detection technology, and in particular relates to a nucleic acid, a kit and a method for simultaneously detecting yellowing phytoplasma, canker pathogenic bacteria and leaf spot pathogenic bacteria. Background technique [0002] Phytoplasma (Phytoplasma) is an important class of pathogens that cause plant diseases. It is highly infective and harms a wide range of hosts. a large number of deaths, causing serious economic losses [0003] Willow yellow disease is a disease caused by Willow Yellow Phytoplasma (WY). It has gradually spread from sporadic cases in the past. In recent years, it has occurred in large areas in North China and Northwest China. Chlorosis turns yellow, but the veins remain normal green, and generally from individual leaves chlorosis to yellow, and gradually spread to the entire canopy. In the late stage of infection, the leaves become thinner, wither and shrink, the branches dry up, and the aff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/04C12N15/11
Inventor李伟张翠萍
OwnerQINGDAO AGRI UNIV