Spine metallothionein gene ilmt2c and its plant expression vector and construction method
A plant expression vector and metallothionein technology, which is applied in the field of molecular biology to achieve the effect of improving the resistance of plants to heavy metals
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1I
[0026] Example 1 IlMT2c clone
[0027] Choose Ma Lin ( Iris lactea var. chinensis ) as material, with 100 µM CdCl 2 Treat the Iris seedlings, take the roots 24 hours later, extract the total RNA from the roots according to the instructions of the Trizol RNA Extraction Kit (TaKaRa), and reverse transcribe 1 μg of the total RNA into cDNA.
[0028] Using the extracted leaf cDNA as a template, design primers IlMT2-F and IlMT2-R for PCR reaction:
[0029] Upstream primer IlMT2-F: ATGTCTTGCTGTGGAGGAAAC (SEQ ID NO.4)
[0030] Downstream primer IlMT2-R: TCATTTGCAGGAGCATGGATC (SEQ ID NO.5)
[0031] 50 μL reaction system: 5.0 μL of 10×RCR Buffer, 1.0 μL of IlMT2-F and IlMT2-R primers (20 μmol L -1 ), dNTP mix 4.0 μL (2.5 mmol L -1 ), Taq DNA Polymerase 0.2 μL, cDNA template 1 μL, ddH 2 O 37.8 μL; reaction program: pre-denaturation at 95 °C for 4 min, then melting at 94 °C for 30 sec, annealing at 55 °C for 30 sec, extension at 72 °C for 2 min, 32 cycles of reaction, and exte...
Embodiment 2
[0032] Example 2. Plant expression vector pCAMBIA1301-220- IlMT2c build
[0033] Design primers IlMT2-ZF, IlMT2-ZR for PCR reaction, in the target gene IlMT2c Respectively introduce enzyme cutting sites upstream and downstream Bam H I and Kpn I, the PCR product is connected to the pMD19-T Simple vector, transformed into TOP10 competent cells, and the positive plasmid is extracted, Bam H I and Kpn I double digested IlMT2c The fragment was ligated with double-digested pCAMBIA1301-220, transformed, and the positive plasmid was extracted, detected by electrophoresis and sequenced to verify that it was SEQ ID NO.1. The specific steps are as follows:
[0034] Upstream primer IlMT2-ZF: CGCGGATCC ATGTCTTGCTGTGGAGGAAAC (SEQ ID NO.2)
[0035] Downstream primer IlMT2-ZR: CGGGGTACC TCATTTGCAGGAGCATGGATC (SEQ ID NO.3)
[0036] Using the root cDNA as a template, high-fidelity enzyme (PrimeSTAR TMHS DNA Polymerase, TaKaRa) for PCR reaction, 50 μL reaction system: 10×HS RCR Buf...
Embodiment 3
[0038] Example 3 Plant expression vector pCAMBIA1301-220- IlMT2c Genetic transformation of Arabidopsis thaliana and identification of its resistance to heavy metals
[0039] ① Competent preparation and freeze-thaw transformation of Agrobacterium strain EHA105
[0040] Pick a single colony of EHA105 from the YEB (50 ug / mL rifampicin) plate, inoculate it in 50 mL of YEB liquid medium containing 50 ug / mL rifampicin, cultivate at 200 rpm at 28°C until the OD value is 0.5, and then Ice-bath the bacterial solution for 30 min, collect the bacterial cells by centrifugation, and suspend in 2 mL of pre-cooled 100mM CaCl 2 (20% glycerol) solution, 200 uL / tube aliquoted for use.
[0041] Take 10 uL of pCAMBIA1301-220- IlMT2c Carrier plasmid, add 200 uL EHA105 competent cells, ice bath for 30 min, freeze in liquid nitrogen for 5 min, 37°C for 5 min, add 800 uL YEB liquid medium, pre-cultivate at 28°C 200 rpm for 4 h, spread the bacterial solution on YEB (50 ug / mL rifampicin + 50 ug / mL ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com