Unlock instant, AI-driven research and patent intelligence for your innovation.

Spine metallothionein gene ilmt2c and its plant expression vector and construction method

A plant expression vector and metallothionein technology, which is applied in the field of molecular biology to achieve the effect of improving the resistance of plants to heavy metals

Active Publication Date: 2021-03-12
INST OF BOTANY JIANGSU PROVINCE & CHINESE ACADEMY OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ma Lin IlMT2 Two members of the family are associated with Cd and Cu resistance, IlMT2c It's Ma Lin IlMT2 A new member of the family, not yet reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Spine metallothionein gene ilmt2c and its plant expression vector and construction method
  • Spine metallothionein gene ilmt2c and its plant expression vector and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1I

[0026] Example 1 IlMT2c clone

[0027] Choose Ma Lin ( Iris lactea var. chinensis ) as material, with 100 µM CdCl 2 Treat the Iris seedlings, take the roots 24 hours later, extract the total RNA from the roots according to the instructions of the Trizol RNA Extraction Kit (TaKaRa), and reverse transcribe 1 μg of the total RNA into cDNA.

[0028] Using the extracted leaf cDNA as a template, design primers IlMT2-F and IlMT2-R for PCR reaction:

[0029] Upstream primer IlMT2-F: ATGTCTTGCTGTGGAGGAAAC (SEQ ID NO.4)

[0030] Downstream primer IlMT2-R: TCATTTGCAGGAGCATGGATC (SEQ ID NO.5)

[0031] 50 μL reaction system: 5.0 μL of 10×RCR Buffer, 1.0 μL of IlMT2-F and IlMT2-R primers (20 μmol L -1 ), dNTP mix 4.0 μL (2.5 mmol L -1 ), Taq DNA Polymerase 0.2 μL, cDNA template 1 μL, ddH 2 O 37.8 μL; reaction program: pre-denaturation at 95 °C for 4 min, then melting at 94 °C for 30 sec, annealing at 55 °C for 30 sec, extension at 72 °C for 2 min, 32 cycles of reaction, and exte...

Embodiment 2

[0032] Example 2. Plant expression vector pCAMBIA1301-220- IlMT2c build

[0033] Design primers IlMT2-ZF, IlMT2-ZR for PCR reaction, in the target gene IlMT2c Respectively introduce enzyme cutting sites upstream and downstream Bam H I and Kpn I, the PCR product is connected to the pMD19-T Simple vector, transformed into TOP10 competent cells, and the positive plasmid is extracted, Bam H I and Kpn I double digested IlMT2c The fragment was ligated with double-digested pCAMBIA1301-220, transformed, and the positive plasmid was extracted, detected by electrophoresis and sequenced to verify that it was SEQ ID NO.1. The specific steps are as follows:

[0034] Upstream primer IlMT2-ZF: CGCGGATCC ATGTCTTGCTGTGGAGGAAAC (SEQ ID NO.2)

[0035] Downstream primer IlMT2-ZR: CGGGGTACC TCATTTGCAGGAGCATGGATC (SEQ ID NO.3)

[0036] Using the root cDNA as a template, high-fidelity enzyme (PrimeSTAR TMHS DNA Polymerase, TaKaRa) for PCR reaction, 50 μL reaction system: 10×HS RCR Buf...

Embodiment 3

[0038] Example 3 Plant expression vector pCAMBIA1301-220- IlMT2c Genetic transformation of Arabidopsis thaliana and identification of its resistance to heavy metals

[0039] ① Competent preparation and freeze-thaw transformation of Agrobacterium strain EHA105

[0040] Pick a single colony of EHA105 from the YEB (50 ug / mL rifampicin) plate, inoculate it in 50 mL of YEB liquid medium containing 50 ug / mL rifampicin, cultivate at 200 rpm at 28°C until the OD value is 0.5, and then Ice-bath the bacterial solution for 30 min, collect the bacterial cells by centrifugation, and suspend in 2 mL of pre-cooled 100mM CaCl 2 (20% glycerol) solution, 200 uL / tube aliquoted for use.

[0041] Take 10 uL of pCAMBIA1301-220- IlMT2c Carrier plasmid, add 200 uL EHA105 competent cells, ice bath for 30 min, freeze in liquid nitrogen for 5 min, 37°C for 5 min, add 800 uL YEB liquid medium, pre-cultivate at 28°C 200 rpm for 4 h, spread the bacterial solution on YEB (50 ug / mL rifampicin + 50 ug / mL ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology, and discloses an iris lacteal metallothioneins gene I1MT2c, and a plant expression vector and a building method thereof. The sequence of the iris lacteal metallothioneins gene I1MT2c is SEQ ID NO. 1. The I1MT2c is a novel heavy-metal-resistant gene; the gene can improve the heavy metal resistant performance. The plant expression vector of the iris lacteal metallothioneins gene I1MT2c is formed by the iris lacteal metallothioneins gene I1MT2c and the plant expression vector. The plant expression vector of the I1MT2c is reported for the first time, and can be directly used for the agrobacterium-mediated genetic transformation; the heavy metal resistant novel germplasm is created; the heavy metal resistance of plants is improved; the vector can be used for plant variety improvement.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to the metallothionein gene of horse lin IlMT2c and a plant expression vector and a construction method thereof. Background technique [0002] Ma Lin ( Iris lactea var. chinensis ) is a perennial herbaceous perennial plant of the genus Iris in the family Iridaceae. It has high ornamental, medicinal, feeding and industrial values ​​and is widely distributed in my country. The root system of Iris is well developed, and it has excellent characteristics such as drought resistance, salt and alkali resistance, and trampling resistance. [1] . At the same time, the heavy metal remediation ability of Iris is strong. Compared with the existing heavy metal remediation plants, it has unique ecological characteristics such as fast growth, large biomass, and wide adaptability. [2] . [0003] Metallothioneins (MTs) are a class of proteins ubiquitous in animals, plants and prokaryotes. MTs ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/66A01H5/00A01H5/10A01H6/20
Inventor 顾春笋刘凉琴王芝权黄苏珍原海燕刘清泉徐晓洋张永侠
Owner INST OF BOTANY JIANGSU PROVINCE & CHINESE ACADEMY OF SCI