Screening, identification and application of SmAP2/ERF82 transcription factor for regulating tanshinone biosynthesis

A technology of ERF82, biosynthesis, applied in the field of plant molecular biology and genetic engineering

Active Publication Date: 2018-02-16
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Whether the AP2 / ERF transcription factor can regulate the biosynthesis of tanshinone compounds in Danshen has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Screening, identification and application of SmAP2/ERF82 transcription factor for regulating tanshinone biosynthesis
  • Screening, identification and application of SmAP2/ERF82 transcription factor for regulating tanshinone biosynthesis
  • Screening, identification and application of SmAP2/ERF82 transcription factor for regulating tanshinone biosynthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1 Screening and identifying members of the AP2 / ERF gene family in the whole genome of Salvia miltiorrhiza

[0019] The genome of Salvia miltiorrhiza was searched and annotated using the hidden Markov model HMM: PF00847 in the Pfam database. A total of 170 AP2 / ERF transcription factor genes were predicted in the Danshen genome, named Sm001-Sm170, and the protein length ranged from 79aa to 595aa. Among them, Sm082 is named SmAP2 / ERF82 in the present invention.

Embodiment 2

[0020] Cloning of embodiment 2 Salvia miltiorrhiza SmAP2 / ERF82 gene

[0021] Design full-length primers according to the open reading frame of the SmAP2 / ERF82 sequence, use the cDNA of Salvia miltiorrhiza as a template, and PCR amplify to obtain the nucleotide sequence of the SmAP2 / ERF82 gene, which is 582 bp in length, such as SEQ ID No.1. The amino acid sequence of SmAP2 / ERF82 was deduced after translation of the nucleotide sequence, including 193 amino acid residues, such as SEQ ID No.2.

Embodiment 3

[0022] Example 3 Functional verification of Danshen SmAP2 / ERF82 gene

[0023] 1) RNAi primer design and PCR amplification. Select a 185bp specific fragment in the SmAP2 / ERF82 gene as the RNAi target region (located at 96-280bp of the gene), design primers at both ends of the target region, and add attB sequence at the 5' end of the primer according to the principle of Gateway, where The F primer adds the attB1 sequence: GGGGACAAGTTTGTACAAAAAAAGCAGGCT, and the R primer adds the attB2 sequence: GGGGACCACTTTGTACAAGAAAGCTGGGT. The primer sequences are as follows:

[0024] F- GGGGACAAGTTTGTACAAAAAAGCAGGCT GATCGCCGCCGTTGTCGGC

[0025] R- GGGGACCACTTTGTACAAGAAAGCTGGGT TGTCGAATGTGCCGAGCCA

[0026] 2) Overexpression primer design and PCR amplification. The attB sequence was added to the 5' end of the full-length primer of the SmAP2 / ERF82 gene. The primer sequences are as follows:

[0027] F- GGGGACAAGTTTGTACAAAAAAGCAGGCT ATGTTGAGAAACGACTCTTT

[0028] R- GGGGACCACTTTGTACA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a coding gene sequence of an AP2 / ERF transcription factor SmAP2 / ERF82 for regulating tanshinone synthesis. The SmAP2 / ERF82 gene provided by the invention has a nucleotide sequence as shown in the SEQ ID No.1. The gene encoded protein has an amino acid sequence as shown in the SEQ ID No.2. A SmAP2 / ERF82-RNAi vector and a SmAP2 / ERF82-overexpression vector are constructed in the invention. Through a genetic transformation method for transformation of red sage root, transgenic hairy roots are obtained. In comparison with a control line, contents of dihydrotanshinone I, cryptotanshinone, tanshinone I and tanshinone II A in the SmAP2 / ERF82-RNAi line are remarkably reduced, and contents of dihydrotanshinone I and cryptotanshinone in the SmAP2 / ERF82-overexpression line areremarkably raised. The SmAP2 / ERF82 provided by the invention has the function of positive regulation of tanshinone compound biosynthesis. The compounds have remarkable efficacy of treating cardiovascular diseases. The invention brings forth new ideas for the research on molecular mechanism for tanshinone synthesis regulation and lays a foundation for the biological research on synthesis of tanshinone.

Description

technical field [0001] The invention belongs to the fields of plant molecular biology and genetic engineering, and specifically relates to the screening, identification and application of an AP2 / ERF transcription factor regulating tanshinone biosynthesis. Background technique [0002] Salvia miltiorrhiza Bunge is a perennial dicotyledonous plant of the genus Salvia in the Labiatae family, and its roots and rhizomes are used as medicine. Salvia miltiorrhiza is bitter in taste, slightly pungent, and slightly cold in nature. Guixin and Liver Meridian have the functions of promoting blood circulation and removing blood stasis, cooling blood and eliminating carbuncle, promoting menstrual flow and relieving pain, clearing away heart-fire and eliminating troubles. Tanshinone is a fat-soluble diterpene compound with important pharmacological activity in Salvia miltiorrhiza, including more than 10 compounds such as tanshinone IIA, tanshinone I, cryptotanshinone, and dihydrotanshinone...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/50
CPCC07K14/415C12N15/8243
Inventor罗红梅张建红吕海舟宋经元季爱加
OwnerINST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI