Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human enterovirus D68 type infectious clone and construction method and application thereof

A technology for infectious cloning and enteroviruses, applied in applications, viruses, antiviral agents, etc., to avoid RNA contamination, save experimental steps and reagents, and simplify the experimental process

Inactive Publication Date: 2018-04-10
TIANJIN UNIV
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] At present, there is no report on the infectious clone of human enterovirus D68, and the infectious clone of human enterovirus D68 has been widely used in animal models, virus replication and pathogenic mechanism, drug screening and drug action mechanism, vaccines and diagnostic reagents. R & D and other aspects have a wide range of application value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human enterovirus D68 type infectious clone and construction method and application thereof
  • Human enterovirus D68 type infectious clone and construction method and application thereof
  • Human enterovirus D68 type infectious clone and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0094] Construction of the full-length cDNA clone of embodiment 1 EV-D68Fermon strain

[0095] (1) Primer design: select the genome sequence of the EV-D68Fermon strain from Genebank, and after comparative analysis, design three pairs of specific primers F1F, F1R, F2F, F2R, F3F and F3R with modified amplification covering the whole genome , primers were synthesized by GENEWIZ company. The specific primer sequences are as follows:

[0096] F1F: ctagctagct taatacgact cactataggt taaaacagct ctggggttg (SEQ ID NO: 2)

[0097] F1R: atagtttagc ggccgcgtca gtaccggtgg ttactatgtt gtg (SEQ ID NO: 3)

[0098] F2F: actgacaccggtccaggtttgggggagtc (SEQ ID NO: 4)

[0099] F2R: gtacgtaccg gttcaatgcgagatttggac (SEQ ID NO: 5)

[0100] F3F: actgacaccg gtttgtttaa taatacacgg c (SEQ ID NO: 6)

[0101] F3R: ttttcctttt gcggccgctt tttttttttttttttttttttttggtcccc aagtgaccaaaatttac (SEQ ID NO: 7)

[0102] (2) RT-PCR: Extract the viral RNA preserved in the laboratory according to the Viral RNA Extraction...

Embodiment 2

[0126] Example 2 Virus rescue

[0127] Extract pHH21-EV-D68 using the plasmid extraction kit Fermon and pHH21-EV-D68 FermonG394C Plasmids are available for use. According to the instructions of Lipofectamine 2000 transfection reagent, the pHH21-EV-D68 Fermon and pHH21-EV-D68 FermonG394C The plasmid was transfected into RD or 293T cell culture plate (24-well plate) with a growth rate of 70%, and the transfection dose was 1 μg. After 6 hours, change to DMEM maintenance solution containing 2% fetal bovine serum, and place the transfected cell culture plate at 37°C, 5% CO 2 Cultured in the incubator, and at the same time set the cells not transfected with the plasmid as the control group. After the cells were transfected, the cytopathic changes were observed. After 5 days, the virus was harvested, and after repeated freezing and thawing three times, it was continuously passaged on the RD cells. The characteristic cytopathic changes (CPE) appeared after 72 hours in the third p...

Embodiment 3

[0129] Embodiment 3 RT-PCR identifies the specific sequence of rescued virus

[0130] Amplification of Viral Genome RgEV-D68 Using Universal Primers 2F and 4R Fermon Nucleotides 958 to 2870 due to rescue virus RgEV-D68 Fermon Nucleotides from the 958th to 2870th nucleotides do not contain the BsmB1 enzyme cutting site, so the rescued virus was identified by BsmB1 enzyme digestion and sequencing analysis, the results are as follows Figure 4(A)-Figure 3(B) shown.

[0131] Depend on Figure 4(A)-Figure 3(B) It can be seen that the rescue virus RgEV-D68 Fermon The amplified gene was not digested by BsmB1, and the sequencing results showed that there were base differences with the wild-type virus.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and particularly relates to a human enterovirus D68 type infectious clone and a construction method and application thereof. The infectious clone is obtained by using a RNA polymerase I system and inserting the full-length cDNA of EVD68Fermon strain; the 1882 and 2593 BsmB1 restriction sites of the full-length cDNA are subjected to the mutationwithout changing amino acids, and the BsmB1 restriction sites are inserted at both ends. The recombinant plasmid containing the complete genomic cDNA clone of EV-D68 strain Fermon fills in the gap ofthe Chinese human enterovirus D68 type infectious clone, and the construction method is simple and highly efficient. At the same time, the application of the human enterovirus D68 type infectious clone provides a powerful tool for the search for the virulence decision sites of enterovirus 68 type and the development of drugs and vaccines resistant to enterovirus D68 type viruses.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a human enterovirus D68 infectious clone and its construction method and application Background technique [0002] Human enterovirus D68 (EV-D68) belongs to the family Picornaradae, the genus Enterovirus, and belongs to group D of human enteroviruses. The EV-D68 genome is a single-stranded positive-sense RNA with a length of about 7.4Kb, consisting of a single open reading frame (ORF) and its flanking untranslated regions (5'UTR and 3'UTR). [0003] In recent years, the virus has frequently erupted in many parts of the world, and there have been more than a dozen deaths during the outbreak, which has attracted widespread attention from the World Health Organization. However, there is very little research on EV-D68 related scientific research. Currently, there is no specific drug for the treatment of EV-D68 infection, and only symptomatic treatment can be used to control the progressio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/40C12N15/86C12N15/66C12N5/10A61K39/125A61K35/765A61P35/00A61P31/14
CPCA61K35/76C12N5/0693C12N7/00C12N15/66C12N15/86C12N2510/00C12N2770/32321C12N2770/32322C12N2770/32343
Inventor 王志云潘明磊高帅王涛
Owner TIANJIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com