A sarna that activates ptpro gene expression and its application in cancer stem cell therapy
A gene expression and tumor technology, applied in the direction of DNA / RNA fragments, anti-tumor drugs, genetic engineering, etc., can solve the problem of not being able to effectively kill CSCs, achieve synergistic inhibition of tumor growth, improve curative effect, and inhibit tumor cell growth Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] The design of embodiment 1saRNA molecule and its influence on PTPRO expression
[0033] 1. Design of saRNA
[0034] The sequence of the PTPRO promoter region was obtained at the website NCBI (http: / / www.ncbi.nlm.nih.gov / ).
[0035] According to the design principle according to the RNA sequence, design and obtain 5 pairs of double-stranded small RNA activation sequences of PTPRO and the corresponding PTPRO promoter region sites of these 5 pairs of sequences. The sequence (SEQ ID NO: 1) from the -3000 site to the -1 site in the PTPRO promoter region is as follows:
[0036] TGATTTGGAGTCTTGAAAATAGCATAATAAGATTTATCATACTTTGGAA GTATTGTATTGAAAAACCAGTCAATAGCTCAAAGAAACACAAAACATGCTC TATGAATTGAAAACCCCACACTGTGGATGACACAGCATTCACATTCTTTATG AGAATCTCTTCTAGGACACTGTTATGGTTTAAGTGCAATAAAAACAAATGA AAGTATTTTATCCAGCAATAGCAATGTAAAATACTTTTCTCTAGAGAGGAAA TTTTCTGTGATTATAAAATAATACTTTCAGTCTTCAGCCCATCTAACCACAAT GTTACTAATAAAATAACAACAATGCCAATTACTAATGCTTTACTACTTACTG TTTACTGTTATTGTTCCTCCAAAGTGGTCCACATAAT...
Embodiment 2
[0062] Example 2 Knockout and overexpression of the PTPRO gene, and verify its impact on tumor cell invasion and migration
[0063] 3.1 Use PTPRO to interfere with the plasmid (see Figure 8 ) Knock out PTPRO of the HK1 cell line, and perform invasion and migration experiments after culturing for 48 hours;
[0064] 3.2 Cell basement membrane invasion assay
[0065] 3.2.1 Matrigel preparation: freeze the matrigel stored in a -20°C refrigerator at 4°C overnight (24h), and turn it into a liquid state;
[0066] 3.2.2 Dilute serum-free medium and Matrigel at 3:1, spread 30-50ul Matrigel on the inner surface of Transwell culture chamber (Millipore) per well, and place in a 37°C incubator for 30min-60min. Observe frequently here, when a "white layer" appears, it indicates that it has become solid;
[0067] 3.2.3 Add 30ul of BSA with a mass fraction of 1% to each well, incubate at 37°C for 30min, and absorb BSA;
[0068] 3.2.4 Wash Matrigel once with serum-free medium;
[0069] 3...
Embodiment 3
[0074] Example 3 Stem cell sphere formation experiment verifies that PTPRO affects tumor cell stemness through c-met
[0075] 5.1 Use the overexpression plasmid to construct the PTPRO overexpression plasmid and the c-met overexpression plasmid (the construction method of the two overexpression plasmids is similar to the construction method of the interference plasmid in Example 4, which is omitted here), and transfect the plasmid into HK1 cells , Puromycin selection to construct stable cell lines.
[0076] 5.2 Take cells in good growth state to make a single cell suspension and count them. take 10 4 The cells were placed in a low-adhesion 6-well plate and cultured in suspension with tumor stem cell medium. After culturing for two weeks, calculate the sphere formation rate (the diameter of the stem cell sphere>=50um).
[0077] The state of cell spheres and the number of spheres are as follows: Figure 4 , 5 As shown, the results show that when PTPRO is overexpressed, the a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More