Application of LncRNA (long non-coding RNA) and medicine using same
A drug and nucleotide sequence technology, applied in the field of medicine and biology, can solve problems such as heart disease prevention, diagnosis and treatment can not achieve satisfactory results, to achieve the prevention and/or treatment of heart disease, the treatment effect is obvious, the use of Environmentally friendly effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0039] In a preferred embodiment, the preparation method of the recombinant virus having the lncRNA of the nucleotide sequence shown in SEQ ID NO.1 comprises:
[0040] The sequence of the LncRNA having the nucleotide sequence shown in SEQ ID NO.1 is connected into the adenovirus vector system to construct a recombinant virus having the LncRNA having the nucleotide sequence shown in SEQ ID NO.1.
[0041] Among them, the adenovirus vector system uses the pSilencer Adeno 1.0-CMV system of Ambion Company.
[0042] In a preferred embodiment, using the mouse genome as a template, the sequence of the LncRNA having the nucleotide sequence shown in SEQ ID NO.1 is obtained by PCR amplification.
[0043] In a preferred embodiment, PCR amplification primers are as shown in the following table:
[0044]
[0045] In a preferred embodiment, the medicine also includes water-soluble fillers, pH regulators, stabilizers, water for injection and osmotic pressure regulators.
[0046] Preferab...
Embodiment 1
[0053] LncRNA overexpression adenovirus vector and negative control adenovirus were constructed. In this example, the mouse genome was used as a template, and the LncRNA sequence was amplified by PCR. The subcloning was connected to Ambion's pSilencer Adeno 1.0-CMV system to construct an LncRNA overexpression adenovirus . Wherein, the LncRNA sequence is shown in the following SEQ ID NO.1:
[0054] 5’-TCGTGAATTTTGTCAGTTTTGTGATATCCTGTTTCGCCTTCACTCCTGCAAATGTGTTATCTGGAATACAAGAAATTATATTTACCATTTTAAAGGTCTCCCAGAATTGAGTGTGCAGTAGCAGAAACTGCCCATCCCACTATAACGTAAAAAAGTGTTCTTACAGGTAATTTACATCCTAATAAAGGGGACGTACACAACCCGAACTGACTCTAAAGCATTTAGTATGGTGAGAGTATTGGGACGCTTGTGCAAACTTAAACACAGAGAGTGAAACCAAACATTAAAGAAGAGTATCCATCTACCCAACTCAGACCTGCGTGAACTATCCACTGGTAAAGTGGGAACTGTTTAAATGGGGAAGACAGGAGAGATCGAAACGTATGCAAATCAATGCAAAAATAGATCTTAGCTCAGTTGTGACTTGGTGCCTCTTAAATGAATGGAAGAGTTGAAAAACTGCCTCTTCACCTGAAGAAATTAGCTATTTTATCAGCAATACTGCTTTGGAAAGTTTTGTGTATACTGTTTTATAACAAAGCCAGGGGCCTTCTGCAAGTTCCGGCTGTTTTTCAGTTTATTTCCTGA...
Embodiment 2
[0061] To detect the change of LncRNA expression level under the stimulation of hydrogen peroxide, the established method was used to culture the primary cardiomyocytes of rat suckling mice (rat suckling mice were purchased from Beijing Medical University, the rat strain was Wistar, and the primary rat suckling mice The preparation of cardiomyocytes can be found in the following documents: W.-Q.Tan, et al, Foxo3a Inhibits Cardiomyocyte Hypertrophythrough Transactivating Catalase J Biol Chem.2008October 31; 283 (44): 29730-29739), cardiomyocytes are treated with hydrogen peroxide , at different times of culture, the total RNA of cells was extracted, and real-time fluorescent quantitative PCR technology was used to detect the expression level of LncRNA. The result is as Figure 1A as shown, Figure 1A The middle ordinate indicates the expression level of LncRNA in primary rat cardiomyocytes during hydrogen peroxide treatment, based on the expression level of LncRNA in primary rat...
PUM
Property | Measurement | Unit |
---|---|---|
Titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap