Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of LncRNA (long non-coding RNA) and medicine using same

A drug and nucleotide sequence technology, applied in the field of medicine and biology, can solve problems such as heart disease prevention, diagnosis and treatment can not achieve satisfactory results, to achieve the prevention and/or treatment of heart disease, the treatment effect is obvious, the use of Environmentally friendly effect

Inactive Publication Date: 2018-06-01
QINGDAO UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The second object of the present invention is to provide a drug for preventing and / or treating heart disease, which includes the above-mentioned LncRNA, so as to alleviate the prevention, diagnosis and treatment of heart disease in the prior art that are still unsatisfactory technical issues with the effect of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of LncRNA (long non-coding RNA) and medicine using same
  • Application of LncRNA (long non-coding RNA) and medicine using same
  • Application of LncRNA (long non-coding RNA) and medicine using same

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0039] In a preferred embodiment, the preparation method of the recombinant virus having the lncRNA of the nucleotide sequence shown in SEQ ID NO.1 comprises:

[0040] The sequence of the LncRNA having the nucleotide sequence shown in SEQ ID NO.1 is connected into the adenovirus vector system to construct a recombinant virus having the LncRNA having the nucleotide sequence shown in SEQ ID NO.1.

[0041] Among them, the adenovirus vector system uses the pSilencer Adeno 1.0-CMV system of Ambion Company.

[0042] In a preferred embodiment, using the mouse genome as a template, the sequence of the LncRNA having the nucleotide sequence shown in SEQ ID NO.1 is obtained by PCR amplification.

[0043] In a preferred embodiment, PCR amplification primers are as shown in the following table:

[0044]

[0045] In a preferred embodiment, the medicine also includes water-soluble fillers, pH regulators, stabilizers, water for injection and osmotic pressure regulators.

[0046] Preferab...

Embodiment 1

[0053] LncRNA overexpression adenovirus vector and negative control adenovirus were constructed. In this example, the mouse genome was used as a template, and the LncRNA sequence was amplified by PCR. The subcloning was connected to Ambion's pSilencer Adeno 1.0-CMV system to construct an LncRNA overexpression adenovirus . Wherein, the LncRNA sequence is shown in the following SEQ ID NO.1:

[0054] 5’-TCGTGAATTTTGTCAGTTTTGTGATATCCTGTTTCGCCTTCACTCCTGCAAATGTGTTATCTGGAATACAAGAAATTATATTTACCATTTTAAAGGTCTCCCAGAATTGAGTGTGCAGTAGCAGAAACTGCCCATCCCACTATAACGTAAAAAAGTGTTCTTACAGGTAATTTACATCCTAATAAAGGGGACGTACACAACCCGAACTGACTCTAAAGCATTTAGTATGGTGAGAGTATTGGGACGCTTGTGCAAACTTAAACACAGAGAGTGAAACCAAACATTAAAGAAGAGTATCCATCTACCCAACTCAGACCTGCGTGAACTATCCACTGGTAAAGTGGGAACTGTTTAAATGGGGAAGACAGGAGAGATCGAAACGTATGCAAATCAATGCAAAAATAGATCTTAGCTCAGTTGTGACTTGGTGCCTCTTAAATGAATGGAAGAGTTGAAAAACTGCCTCTTCACCTGAAGAAATTAGCTATTTTATCAGCAATACTGCTTTGGAAAGTTTTGTGTATACTGTTTTATAACAAAGCCAGGGGCCTTCTGCAAGTTCCGGCTGTTTTTCAGTTTATTTCCTGA...

Embodiment 2

[0061] To detect the change of LncRNA expression level under the stimulation of hydrogen peroxide, the established method was used to culture the primary cardiomyocytes of rat suckling mice (rat suckling mice were purchased from Beijing Medical University, the rat strain was Wistar, and the primary rat suckling mice The preparation of cardiomyocytes can be found in the following documents: W.-Q.Tan, et al, Foxo3a Inhibits Cardiomyocyte Hypertrophythrough Transactivating Catalase J Biol Chem.2008October 31; 283 (44): 29730-29739), cardiomyocytes are treated with hydrogen peroxide , at different times of culture, the total RNA of cells was extracted, and real-time fluorescent quantitative PCR technology was used to detect the expression level of LncRNA. The result is as Figure 1A as shown, Figure 1A The middle ordinate indicates the expression level of LncRNA in primary rat cardiomyocytes during hydrogen peroxide treatment, based on the expression level of LncRNA in primary rat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention provides application of LncRNA (long non-coding RNA) and a medicine using the same, and relates to the technical field of medical biology. The LncRNA provided by the invention has the nucleotide sequence shown as SEQ ID NO.1, and experiments find that the expression of the LncRNA is significantly decreased in cardiomyocytes suffering from cell death and heart tissues and the LncRNA has a protective effect on myocardial infarction and myocardial fibrosis, so that through overexpression of the LncRNA, the purposes of preventing and / or treating heart diseases can be achieved. The invention further provides the medicine comprising the LncRNA. The medicine can achieve the purposes of preventing and / or treating the heart diseases through the overexpression of the LncRNA; meanwhile,the medicine is obvious in therapeutic effect, wide in application range and friendly to using environment.

Description

technical field [0001] The invention relates to the field of medical biotechnology, in particular to the application of LncRNA and the medicine using it. Background technique [0002] Cardiovascular disease is the number one cause of human death worldwide, and more people die each year from cardiovascular disease than from any other cause. About 17.7 million people died from cardiovascular diseases in 2015, accounting for 31% of the global deaths. In 2015, noncommunicable diseases accounted for 17 million premature deaths (under the age of 70 years), 37% of which were caused by cardiovascular diseases. With the improvement of human living standards and the change of diet structure, the mortality rate of cardiovascular disease is on the rise, surpassing cancer as the number one cause of death. According to the latest statistical results released recently, the prevalence of hypertension among residents aged 18 and above is 18.8%, and it is estimated that the number of patien...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7105A61K48/00A61P9/00A61P9/10A61P9/04
CPCA61K31/7105
Inventor 王昆李培峰周露玙
Owner QINGDAO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com