Check patentability & draft patents in minutes with Patsnap Eureka AI!

Tandem leader peptide and method for improving expression quantity of recombinant small molecular proteins

A technology of small molecule protein and leader peptide, applied in the field of genetic engineering, can solve the problem of low expression of small molecule protein

Active Publication Date: 2018-06-12
ZHUHAI JINBAIKANG BIOLOGICAL TECH CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In order to solve the problem of low expression of small molecular proteins in the prior art, the present invention provides a tandem leader peptide that improves the expression of recombinant small molecular proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tandem leader peptide and method for improving expression quantity of recombinant small molecular proteins
  • Tandem leader peptide and method for improving expression quantity of recombinant small molecular proteins
  • Tandem leader peptide and method for improving expression quantity of recombinant small molecular proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Implementation 1 Expression of Human Insulin Precursor Protein

[0045] This embodiment specifically includes the following steps:

[0046] (1) Synthetic human insulin precursor coding gene

[0047] Design its coding gene according to the amino acid sequence of human insulin precursor protein (SEQ ID NO:1), and then optimize it from the aspects of codon bias, GC content, codon adaptation index CAI, hairpin structure and cis-acting elements Gene sequence, then add the double stop codon TAATAG at the 3' end of the sequence, add the restriction enzyme Xho I sequence CTCGAG at the 5' end, and add the restriction enzyme NotI sequence GCGGCCGC at the 3' end to obtain the human insulin precursor coding gene (SEQ ID NO: 9 ), this step entrusts Nanjing GenScript Biotechnology Co., Ltd. to carry out the whole gene synthesis.

[0048] (2) Construction of a recombinant expression plasmid containing the human insulin precursor coding gene

[0049] The gene synthesized in step (1)...

Embodiment 2

[0057] In this example, the cloning plasmid pUC57-IP was used as a template, and the upstream primer (5'-ctcgagaagagagaagaaggtgaaggtgaaggtgaaccaaagtttgttaaccaacatttgtg) and the downstream primer (5'-agcggataacaatttcacacagga) were used for PCR amplification to obtain the human insulin precursor fusion protein (SEQ ID NO: 2) coding genes. Connect to the plasmid pGBC3 digested by XhoI and NotI, transform the Escherichia coli TOP10, use the sequencing primer 5'gactggttccaattgacaagc to sequence the ampicillin-resistant transformants, and select the transformants without gene mutation and correct reading frame, That is, the recombinant expression plasmid containing the gene encoding the human insulin precursor fusion protein is obtained. The method described in Example 1 was used to obtain engineering bacteria expressing human insulin precursor fusion protein (SEQ ID NO: 2), and three engineering bacteria were picked for shake flask fermentation.

[0058] Detected by RP-HPLC (C18 c...

Embodiment 3

[0060] According to the amino acid sequence of human insulin precursor fusion protein (SEQ ID NO:3), the coding gene was designed, and the optimized gene sequence was obtained through codon optimization, and then a double stop codon TAATAA was added at the 3' end of the sequence, and a restriction enzyme was added at the 5' end The Xho I sequence CTCGAG, and the restriction enzyme NotI sequence GCGGCCGC was added to the 3' end to obtain the human insulin precursor coding gene (SEQ ID NO: 10). Nanjing GenScript Biotechnology Co., Ltd. was entrusted to carry out the whole gene synthesis, and the synthesized gene was inserted into the pUC57 plasmid digested with the restriction enzyme EcoRⅤ to obtain the cloning plasmid. Use the method described in Example 1 to construct a recombinant expression plasmid, and then use the electroporation method to introduce the recombinant expression plasmid into Pichia pastoris GS115 to obtain a transformant, which is an engineered bacterium expre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Expressionaaaaaaaaaa
Expressionaaaaaaaaaa
Login to View More

Abstract

The invention provides a tandem leader peptide for improving the expression quantity of recombinant small molecular proteins. The leader peptide meets the following general formula: Xn------X3-X2-X1-Y, wherein n is an integer between 8 and 20, X is independently selected from Glu, Asp, Pro, Ala, Gly, His, Ser and Thr, and Y is Arg or Lys. The invention also provides a method for improving the expression quantity of the recombinant small molecular proteins in yeast cells by using the tandem leader peptide. By using the leader peptide provided by the invention, the expression quantity of the small molecular proteins is effectively improved, the expression quantity of human insulin precursor fusion proteins is improved by 4.36 times, and the expression quantity of human epidermal growth factors is improved by 1.47 times; and furthermore, the small molecular fusion proteins provided by the invention can be subjected to simple protease scission to obtain small molecular proteins and do notneed to add an additional step for removing residual amino acids. Compared with an existing tandem expression technique, the small molecular proteins obtained by the method have natural N-terminals and are of important application value in the field of biological medicines.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a tandem leader peptide and a method for increasing the expression of recombinant small molecule proteins. Background technique [0002] As a foreign protein expression system, the yeast expression system has been widely used in the field of genetic engineering due to the advantages of both prokaryotic and eukaryotic expression systems. The application of this system can express proteins at a high level and has post-translational modification functions , so it is recognized as a powerful tool for expressing large-scale proteins. However, since small molecular proteins are easily degraded in genetically engineered cells, it is difficult to directly achieve recombinant expression. Even if a few small molecular proteins are directly recombinantly expressed, their expression is often very low due to degradation by proteases in the host cell. In order to achieve effecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K7/06C07K7/08C12N15/62C12N15/81C12N15/67C12R1/84C12R1/865
CPCC07K7/06C07K7/08C07K14/62C07K2319/02C12N15/62C12N15/67C12N15/81C12N15/815
Inventor 赖红星马文柱夏玉平祝捷姚元锋肖拥军罗湘冀
Owner ZHUHAI JINBAIKANG BIOLOGICAL TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com