Method for producing N-acetylglucosamine by jointly using glucose and xylose based on CRISPRi

A technology of glucose and acetamido, applied in the field of genetic engineering, can solve the problems of glucose metabolism regulation, waste and the like, and achieve the effects of extracellular improvement, efficient co-utilization, and yield improvement

Active Publication Date: 2018-06-12
JIANGNAN UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing technology only strengthens the metabolic pathway of xylose, and does not regulate the metabolism of glucose. When cells can utilize both glucose and xylose, more glucose can be introduced into the synthetic pathway of the target product. To avoid waste of carbon sources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing N-acetylglucosamine by jointly using glucose and xylose based on CRISPRi
  • Method for producing N-acetylglucosamine by jointly using glucose and xylose based on CRISPRi
  • Method for producing N-acetylglucosamine by jointly using glucose and xylose based on CRISPRi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1: Construction of CRISPRi system

[0045] The CRISPRi system constructed in the present invention consists of two integration vectors, namely pLCx-dCas9 (shown in SEQ ID NO.5) and psga (shown in SEQ ID NO.8). Among them, pLCx-dCas9 is used to integrate the dCas9 protein induced by xylose into the lacA site of the Bacillus subtilis genome, and psga can integrate sgRNA expression into the amyE site of the Bacillus subtilis genome.

[0046] In the construction process of pLCx-dCas9, an integrated expression vector pLCx that can be used in Bacillus subtilis was firstly constructed, which was constructed by one-step cloning of five fragments F1, F2, F3, F4 and F5, F1- The sequence of F5 is shown in SEQ ID NO.9-SEQ ID NO.13. Among them, F1 contains the spectinomycin resistance gene aadA and the E. coli replicon pMB1, F2 is the 800-base fragment of the 5' end of the Bacillus subtilis lacA gene, F3 is the chloramphenicol resistance fragment containing lox71 and lox...

Embodiment 2

[0048] Example 2: Using the CRISPRi system to regulate the expression of zwf, pfkA and glmM

[0049] Primers were designed according to the sequences of the three genes zwf, pfkA and glmM, and the vector psga was used as a template for reverse PCR to obtain three vectors psga-zwf, psga- pfkA and psga-glmM. The primers used by psga-zwf are sg-F:GTTTTAGGCTAGAAATAGCAAGTTAAAATAAG and sg-zwf-R:

[0050] TTTCTAGCTCTAAAACTGGTCTAATGAGGATCTTCGACATTTATTGTACAACACGAGCC,psga-pfkA所用引物为sg-F:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG与sg-pfkA-R:TCTAGCTCTAAAACCGGGAATGAACGCAGCAGTTACATTTATTGTACAACACGAGCC,psga-glmM所用引物为sg-F:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG与sg-glmM-R:

[0051] TTTCTAGCTCTAAAACATAGTGAGCTTACACCTGAGACATTTATTGTACAACACGAGCC.

[0052] The vectors psga-zwf, psga-pfkA and psga-glmM were used as templates respectively, and the three sgRNAs were assembled into the linearized psga vector by the method of Golden Gate, and the vector psga-zpg (Golden Gate For the assembly method, please refer to the...

Embodiment 3

[0054] Example 3: Fermentation of recombinant Bacillus subtilis BSGNX-dCas9-zpg to produce acetylglucosamine

[0055] Using the recombinant bacillus constructed in Example 2 to carry out shake flask fermentation, with Bacillus subtilis BSGNY-P veg -glmS -P 43 -GNA1 was grown and fermented under the same conditions as a control. The seeds cultivated at 37°C and 220rpm for 12h were transferred to the fermentation medium with a 5% inoculation amount, and xylose with a final concentration of 15g / L was added 6h after inoculation, and cultivated at 37°C and 220rpm for 48h. The content of acetylglucosamine in the final fermentation supernatant reached 20.5g / L, which was higher than that of the starting strain (BSGNY-P veg -glmS -P 43 -GNA1) increased by 32.2%; simultaneously the yield of recombinant Bacillus subtilis fermented acetylglucosamine provided by the present invention was 0.612g / g glucose, which was 96.8% higher than that of the starting strain (results are shown in Tabl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing N-acetylglucosamine by jointly using glucose and xylose based on CRISPRi and belongs to the field of genetic engineering. Through the method, bacillus subtilis BSGNY-Pveg-g1mS-P[43]-GNA1 is used as a starting strain; dCas9 induced by xylose and three sgRNA expression fragments which respectively act on three genes including zwf, pfkA and g1mM are integrated on a genome; the strain is used for carrying out flask shaking fermentation; the yield of N-acetylglucosamine reaches up to 20.5g / L; and the yield of N-acetylglucosaminein per gram of glucose is 0.612g / g; meanwhile, the recombinant bacillus subtilis is capable of efficiently and jointly using glucose and xylose; the method lays the foundation for production of glucosamine through the modified bacillus subtilis in further metabolic engineering and the industrialization thereof.

Description

technical field [0001] The invention relates to a CRISPRi-based method for co-utilizing glucose and xylose to produce N-acetylsaminoglycan, belonging to the field of genetic engineering. Background technique [0002] Acetyl glucosamine is a kind of monosaccharide in organisms, which widely exists in bacteria, yeast, mold, plants and animals. In the human body, acetylglucosamine is the synthetic precursor of the disaccharide unit of glycosaminoglycan, which plays an important role in the repair and maintenance of cartilage and joint tissue functions. Therefore, acetyl glucosamine is widely used as a drug and nutritional dietary supplement to treat and repair joint damage. In addition, acetylglucosamine also has many applications in the field of cosmetics. At present, acetyl glucosamine is mainly produced by acid-decomposing chitin in shrimp shells or crab shells. The waste liquid produced by this method is relatively serious for environmental pollution, and the obtained pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/75C12N15/90C12P19/26C12R1/125
CPCC12N9/22C12N15/113C12N15/75C12N15/902C12N2310/10C12N2810/10C12P19/26C12N2310/20C12P19/02C12N2310/14C12N2500/34C12N2510/02C12N2800/80
Inventor刘龙陈坚堵国成李江华武耀康陈泰驰
OwnerJIANGNAN UNIV