Check patentability & draft patents in minutes with Patsnap Eureka AI!

ACCase mutant protein enabling plant to have herbicide resistance, and application thereof

A mutant and herbicide technology, applied in the field of plant protein and plant herbicide resistance, can solve the problem of undetermined mechanism of herbicide action

Pending Publication Date: 2018-08-03
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, at present, the mechanism of action of ACCase inhibitor herbicides has not been determined, and it is difficult to predict in advance whether mutations in other amino acid sites of the ACCase protein will cause herbicide resistance. With some luck, a new herbicide resistance locus in the ACCase protein may be discovered

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ACCase mutant protein enabling plant to have herbicide resistance, and application thereof
  • ACCase mutant protein enabling plant to have herbicide resistance, and application thereof
  • ACCase mutant protein enabling plant to have herbicide resistance, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1: The process of obtaining quizalofop herbicide-resistant mutants in rice

[0058] Divide 120 kg of Zhennuo No. 19 (gifted by Zhenjiang Agricultural Science Institute in the hilly area of ​​Jiangsu) (this is M0, soaked in water for 2 hours) in 6 times with 0.4-0.6% (w / w) ethyl methanesulfonate (EMS) at room temperature Soak under water for 6-9 hours, shake the seeds every 1 hour during this period; discard the EMS solution, soak the seeds 5 times in tap water, 5 minutes each time, then rinse the seeds with tap water overnight, sow in the field the next day, and perform routine fertilizer and water management (this is M1). After the plants are mature, the seeds are mixed, dried, and stored for the winter. Sow in the field the following year. When the rice (this is M2) seedlings grow to the three-leaf stage, spray 3mL quizalofop / L water (recommended minimum use concentration is 1.5mL quizalofop / 1L water), and it will still be normal green after 1 month. And...

Embodiment 2

[0059] Example 2: Obtaining the full-length gene of wild-type Accase in rice Zhennuo 19

[0060] Genomic DNA was extracted from the leaves of Zhennuo 19 wild-type plants, and primers were designed according to the Nipponbare ACCase gene in NCBI (NCBI: XM_015783727) for amplification, and KOD DNA polymerase (purchased from Toyobo Company) was used to amplify the ACCase gene. The reaction system is as follows:

[0061] 10×Buffer5.0μl

[0062] 10 μM forward primer (GTCAGATTTCACACATCTGGGGAT) 1.0 μl

[0063] 10 μM reverse primer (ACTTGCACTTTCATCTGGCAGAAC) 1.0 μl

[0064] 20-30ng / μL rice Zhennuo 19 genomic DNA 1.0μl

[0065] 2mMdNTP 2.0μl

[0066] 25mM MgSO 4 2.0μl

[0067] KOD DNApolymerase polymerase (1U / μl) 1.0μl

[0068] Add sterile water to a total volume of 50 μl

[0069] The PCR amplification reaction program adopts a two-step method, annealing and extension are combined together, and 68 degrees are used.

[0070]The program is as follows: pre-denaturation: 94°C for ...

Embodiment 3

[0073] Example 3: Molecular level identification of quizalofop herbicide-resistant rice mutants

[0074] Among all the herbicide-resistant rice mutant plants obtained in the above-mentioned Example 1, the leaves of multiple mutant plants and the leaves of Zhennuo No. 19 wild-type plant were selected, and genomic DNA was extracted respectively, and ACCase-F (GTCAGATTTCACACATCTGGGGAT) and ACCase-R ( ACTTGCACTTTCATCTGGCAGAAC) for PCR amplification, respectively. The PCR amplification conditions and amplification system were the same as in Example 2. The sequencing results found that: compared with the wild-type plants in Example 2, we obtained five rice mutants in total. mutations occurred. The specific mutation content is as follows:

[0075] In the ACCase gene sequence of the ACCase-5374 mutant, the 5374th nucleotide of its nucleotide sequence is mutated from A to T, resulting in the 1792nd amino acid mutation of its encoded amino acid sequence from isoleucine to leucine, It...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice ACCase mutant protein. The amino acid sequence of the ACCase mutant protein has any one or more of mutations in the 1792th position, the 2015th position, the 2038th position, the 2052th position and the 2089th position of the amino acid sequence of the rice ACCase. The invention also discloses a nucleic acid or a gene for encoding the protein. A plant expressing themutant protein has resistance (tolerance) to an acetyl-CoA carboxylase herbicide. After 3 mL quizalofop-ethyl / L water (2 times recommended concentration) is applied to a rice three-leaf seedling of the rice ACCase protein, the plant can still normally grow and seed.

Description

technical field [0001] The invention belongs to the field of plant protein and plant herbicide resistance, and relates to an ACCase mutant protein for making plants resistant to herbicides and applications thereof; specifically, the invention relates to an acetyl-CoA carboxylase (ACCase) mutant protein of rice, The mutant protein can endow plants, especially rice, with the characteristic of resistance to acetyl coenzyme A carboxylase inhibitor herbicides. The invention discloses the nucleotide sequence and amino acid sequence of the mutant protein, as well as their application in the field of plant herbicide resistance. Background technique [0002] Weeds in farmland are one of the main causes of crop yield reduction. Compared with the traditional methods of relying on cultivation measures, manual weeding and mechanical weeding, the use of chemical herbicides is recognized as the most efficient, simple and economical method of controlling weeds in farmland. [0003] Acetyl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/00C12N15/52C12N15/82C12Q1/6895
CPCC12N9/93C12N15/8213C12N15/8274C12Q1/6895C12Q2600/13C12Y604/01002
Inventor 张保龙王金彦凌溪铁
Owner JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More