Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Microorganism producing poly-γ-glutamic acid and its construction method and application

A technology of glutamic acid, production method, applied in the field of genetic engineering and microbial fermentation

Active Publication Date: 2021-09-10
HUBEI UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still no research on the transmembrane transport process of γ-PGA and its application in promoting the efficient synthesis of γ-PGA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microorganism producing poly-γ-glutamic acid and its construction method and application
  • Microorganism producing poly-γ-glutamic acid and its construction method and application
  • Microorganism producing poly-γ-glutamic acid and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of pHY-plC expression plasmid

[0031] According to the gene sequence of the plC gene in the genome DNA sequence of Bacillus thuringiensis BM171, design the upstream primer (plC-F) and the downstream primer (plC-R) of plC gene; And take the genome DNA of Bacillus thuringiensis BM171 as template, respectively The upstream primer (plC-F) and downstream primer (plC-R) of the plC gene were used for PCR amplification to obtain a plC gene fragment with a length of 852bp (as shown in SEQ ID NO.2). The sequences of primers plC-F and plC-R are as follows.

[0032] SEQ ID NO.3:plC-F:TAAGAGAGGAATGTACACATGAAAAAGAAAGTACTTGCTT

[0033] SEQ ID NO.4:plC-R:TCCGTCCTCTCTGCTCTTTTAACGATTTCCGTACGTATCA

[0034] Using the genomic DNA of Bacillus subtilis 168 as a template and P43-F and P43-R as primers, the P43 promoter was amplified by PCR; using the genomic DNA of Bacillus licheniformis WX-02 as a template, TamyL-F and TamyL-R were Primers, amylase terminator TamyL ...

Embodiment 2

[0043] Example 2 Construction of Bacillus licheniformis WX-02 / pHY-plC

[0044] The free expression vector pHY-plC was transformed into Bacillus licheniformis WX-02 (this strain has been disclosed in Chinese patent CN106497857A), screened at 37°C on a medium containing tetracycline resistance, and obtained For the transformants, colony PCR verification was carried out on the extracted plasmids of the transformants (the primers used were: pHY-F and pHY-R). The PCR verification result of the positive transformant was an electrophoresis band at 1934bp, combined with the sequence determination results, it was proved that the free expression vector pHY-plC was successfully transferred into Bacillus licheniformis WX-02, and the Bacillus licheniformis engineering bacterium WX-02 / pHY- The construction of plC was successful, and the control strain WX-02 / pHY300 was to transform the plasmid pHY300 into WX-02, and the operation steps were the same as the construction of WX-02 / pHY-plC.

Embodiment 3

[0045] Example 3 Fermentation test of Bacillus licheniformis WX-02 / pHY-plC to produce γ-PGA

[0046] 1. Seed culture

[0047] Activate Bacillus licheniformis WX-02 / pHY-plC and WX-02 / pHY300, that is, inoculate 1% by volume from a glycerol tube into 5mL LB medium, culture at 180-300r / min at 37°C for 10 ~ 14 hours, and then inoculate the bacterium liquid after the activation of the strain in the LB medium with a volume percentage of 1% inoculum, and then cultivate it at 180 ~ 300 r / min and 37 ° C for 10 ~ 12 hours to obtain the seed culture bacterium liquid.

[0048] 2. Production of γ-PGA by fermentation

[0049] In order to better analyze the effect of the expression of plC on the fermentative production of γ-PGA by Bacillus licheniformis, fermentation experiments were carried out using the media shown in Table 1, respectively.

[0050] Table 1 Fermentation medium formula

[0051]

[0052]

[0053] The units of the above medium components are g / L.

[0054] 25-150 mL o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a microorganism producing poly-γ-glutamic acid and its construction method and application. The poly-γ-glutamic acid-producing microorganism disclosed in the present invention is a microorganism overexpressing phospholipase C, the overexpression is the introduction of one or more copies of the phospholipase C coding gene and / or the replacement of the expression element of phospholipase C It is an expression element with higher activity. In the microorganism obtained by increasing the expression of phospholipase C, the yield of poly-γ-glutamic acid produced by fermentation is significantly improved. The invention provides a new strategy for improving the yield of poly-γ-glutamic acid produced by microbial fermentation and reducing the production cost.

Description

technical field [0001] The invention relates to the fields of genetic engineering and microbial fermentation, in particular to a microorganism producing poly-γ-glutamic acid and its construction method and application. Background technique [0002] Poly-γ-glutamic acid (γ-PGA) is a kind of natural anionic biopolymer, mainly composed of L-glutamic acid and D-glutamic acid monomers through γ-amide bonds aggregated. The γ-PGA molecule has a large number of free negatively charged carboxyl groups, which makes it capable of combining with a large number of metal cations and has hydrophilic properties. These structural characteristics make γ-PGA have good water solubility, strong adsorption capacity, biodegradability, non-toxic to human body and environment, etc., and have a wide range of applications in the fields of medicine, food, cosmetics, environmental protection and agriculture. [0003] There are mainly two sources of L-glutamic acid as the synthetic precursor of γ-PGA, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12P13/02C12R1/10
CPCC12N9/16C12P13/02C12Y301/04003
Inventor 陈守文莫非蔡冬波何鹏辉陈耀中王世依马昕
Owner HUBEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com