Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting virus titer of slow viruses

A real-time fluorescence quantification and virus titer technology, applied in the field of kits and real-time fluorescence quantitative PCR primers, can solve problems such as inability to accurately measure virus titers, inaccurate virus titer detection results, and inability to reflect the true infection activity of the virus.

Active Publication Date: 2018-09-21
YUNZHOU BIOSCIENCES (GUANGZHOU) INC
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, both the free P24 protein and the P24 protein on the inactive virus particles can react with the antibody to affect the results, so the titer of the virus cannot be accurately determined
[0007] In the RT-qPCR method, the efficiency of RNA will affect the final result, and the RT-qPCR method will also count the nucleic acid of virus particles that contain nucleic acid but lose their infectious activity, which cannot reflect the real infection activity of the virus. The titer detection of the virus The results are inaccurate, thus limiting the application of the method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting virus titer of slow viruses
  • Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting virus titer of slow viruses
  • Real-time fluorescent quantitative PCR (polymerase chain reaction) primer, kit and method for detecting virus titer of slow viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] The design of embodiment 1 specific primer

[0040] According to the published virus sequence, the present invention selects the envelope region of lentivirus to design primers; conducts preliminary screening on the designed primers to obtain a set of primer pairs with high versatility, good sensitivity and specificity, Its nucleotide sequence is as follows:

[0041] ENV-F:CGCAGTTAATCCTGGCCTGTTA (SEQ.ID:NO.1);

[0042] ENV-R: ATCCTTTGATGCACACAATAGAGG (SEQ. ID: NO. 2).

[0043] Using the lentiviral shuttle plasmid as a template, the amplified sequence is:

[0044] cgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcatttataatacagtagcaaccctctattgtgtgcatcaaaggat (SEQ.ID:NO.3);

[0045] The length of the amplified fragment is 144bp.

[0046] Internal reference BMP2 (Homo sapiens bone morphogenetic protein 2, bone morphogenetic protein 2) primers:

[0047] BMP2-F:TAGGGTAGACAGAGCCAAGG (SEQ.ID:NO.4);

[0048] BMP2-R: AGCACAGG...

Embodiment 2

[0052] Preparation and real-time quantitative PCR (qPCR) detection of embodiment 2 standard

[0053] 1. Preparation of Standards

[0054] Use the ENV-F, ENV-R, BMP2-F, BMP2-R primers of Example 1 to amplify the target fragment, and connect the amplified product to pMD TM 18-T vector. The constructed vector was double digested with AhdI and NdeI, and the digested product was recovered and its concentration and purity were determined using NanoDrop. For samples that meet the purity, the number of molecules is calculated according to the molecular weight of the fragment and Avogadro's constant, and used as standards for virus quantification, which are ENV standards and internal reference BMP2 standards.

[0055] The specific calculation formula is: sample copy number per 1uL fragment = A×N×10 -9 / M. Wherein A is the measured DNA concentration in ng / uL; N is Avogadro's constant (6.02×10 23 / mol); M is the molecular weight of the fragment.

[0056] 2. Real-time quantitative PCR...

Embodiment 3

[0068] Example 3 Real-time fluorescent quantitative PCR of target cell genomic DNA

[0069] (1) Virus transduction of 293T cells:

[0070] 3 x 10 per well 5 Inoculate 293T cells into a 6-well plate, take a well of cells before virus transduction the next day, trypsinize and count the cells, and save the counting results as B. Use 293T complete medium to dilute the virus product 100 times, take 50uL of the diluted virus solution and add it to one well of a 6-well plate, and add 10uL, 0.5mg / mL polybrene (polybrene) to promote transduction, and keep one The cells that were not transduced with any virus were used as a negative control and placed in a 37-degree incubator to continue culturing.

[0071] (2) Extraction of cellular genomic DNA:

[0072] After 48 hours of virus transduction, the cells were collected, and the genomic DNA of the target cells was extracted with a blood tissue cell genome extraction kit (Tiangen, DP304).

[0073] (3) Quantitative PCR analysis:

[0074...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a real-time fluorescent quantitative PCR (polymerase chain reaction) primer, a kit and a method for detecting the virus titer of slow viruses. The primer falls on an envelope of the slow viruses, and the titer can be detected without a fluorescent label. In addition, the successfully integrated viruses infecting cells are detected, the real infection vitality of the virusescan be embodied, and the primer cannot be affected by cell genome DNA (deoxyribonucleic acid) extraction efficiency and has the advantages of simplicity and convenience in operation and high sensitivity.

Description

technical field [0001] The invention relates to the technical field of lentivirus virus titer detection, in particular to a real-time fluorescence quantitative PCR primer, a kit and a method for detecting lentivirus virus titer. Background technique [0002] Lentiviral vector (LVs) is a viral vector system modified on the basis of HIV-1 (human immunodeficiency virus type I), which is different from general retroviral vectors. Infection ability, can efficiently introduce the target gene (or RNAi) into animal and human primary cells or cell lines. The genome of the lentivirus is two identical positive-strand RNAs. After infecting cells, it is reverse-transcribed into DNA by its own reverse transcriptase in the cytoplasm to form a pre-DNA integration complex. After entering the nucleus, the DNA is integrated into the cell genome middle. The integrated DNA transcribes mRNA, returns to the cytoplasm, expresses the target protein, or produces RNAi interference. [0003] The exp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/6851C12Q1/702C12Q2600/166C12Q2531/113C12Q2545/101C12Q2563/107
Inventor蓝田施金秀陈银娜
OwnerYUNZHOU BIOSCIENCES (GUANGZHOU) INC